ID: 1010300142

View in Genome Browser
Species Human (GRCh38)
Location 6:74250994-74251016
Sequence CCTACTATCTAGCAGAAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010300142_1010300145 1 Left 1010300142 6:74250994-74251016 CCCTCTTTCTGCTAGATAGTAGG No data
Right 1010300145 6:74251018-74251040 AACTTTATCTAGATAATTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010300142 Original CRISPR CCTACTATCTAGCAGAAAGA GGG (reversed) Intergenic
No off target data available for this crispr