ID: 1010303571

View in Genome Browser
Species Human (GRCh38)
Location 6:74289516-74289538
Sequence CCTGGCTGCACCTCTGCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010303562_1010303571 24 Left 1010303562 6:74289469-74289491 CCTAAATATTATGGTACTTACTT No data
Right 1010303571 6:74289516-74289538 CCTGGCTGCACCTCTGCTGGGGG No data
1010303565_1010303571 -4 Left 1010303565 6:74289497-74289519 CCTGAAGGCTGGTTTCTCACCTG No data
Right 1010303571 6:74289516-74289538 CCTGGCTGCACCTCTGCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010303571 Original CRISPR CCTGGCTGCACCTCTGCTGG GGG Intergenic
No off target data available for this crispr