ID: 1010305105

View in Genome Browser
Species Human (GRCh38)
Location 6:74310589-74310611
Sequence CATTAACTGCACAAATTGTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010305105_1010305108 -1 Left 1010305105 6:74310589-74310611 CCGTACAATTTGTGCAGTTAATG No data
Right 1010305108 6:74310611-74310633 GCAATTATTACAGGGTCCTGAGG 0: 91
1: 113
2: 443
3: 402
4: 257
1010305105_1010305106 -10 Left 1010305105 6:74310589-74310611 CCGTACAATTTGTGCAGTTAATG No data
Right 1010305106 6:74310602-74310624 GCAGTTAATGCAATTATTACAGG 0: 95
1: 60
2: 222
3: 331
4: 430
1010305105_1010305110 26 Left 1010305105 6:74310589-74310611 CCGTACAATTTGTGCAGTTAATG No data
Right 1010305110 6:74310638-74310660 ATACATCCTCCTCAGCTGACAGG 0: 119
1: 124
2: 73
3: 35
4: 107
1010305105_1010305107 -9 Left 1010305105 6:74310589-74310611 CCGTACAATTTGTGCAGTTAATG No data
Right 1010305107 6:74310603-74310625 CAGTTAATGCAATTATTACAGGG 0: 101
1: 89
2: 278
3: 385
4: 507

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010305105 Original CRISPR CATTAACTGCACAAATTGTA CGG (reversed) Intergenic
No off target data available for this crispr