ID: 1010306449

View in Genome Browser
Species Human (GRCh38)
Location 6:74328765-74328787
Sequence CAATGGGAATGAAGAGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010306449_1010306452 5 Left 1010306449 6:74328765-74328787 CCAACTTCTCTTCATTCCCATTG No data
Right 1010306452 6:74328793-74328815 CATCCACCCTTCCCAGTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010306449 Original CRISPR CAATGGGAATGAAGAGAAGT TGG (reversed) Intergenic
No off target data available for this crispr