ID: 1010311211

View in Genome Browser
Species Human (GRCh38)
Location 6:74388206-74388228
Sequence CTGCATCCCTTGAATAATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010311211_1010311217 14 Left 1010311211 6:74388206-74388228 CCTTAATTATTCAAGGGATGCAG No data
Right 1010311217 6:74388243-74388265 CTCTTTAGGAAAAATTTTAGGGG No data
1010311211_1010311216 13 Left 1010311211 6:74388206-74388228 CCTTAATTATTCAAGGGATGCAG No data
Right 1010311216 6:74388242-74388264 ACTCTTTAGGAAAAATTTTAGGG No data
1010311211_1010311213 0 Left 1010311211 6:74388206-74388228 CCTTAATTATTCAAGGGATGCAG No data
Right 1010311213 6:74388229-74388251 CCAACCTAAGATGACTCTTTAGG No data
1010311211_1010311215 12 Left 1010311211 6:74388206-74388228 CCTTAATTATTCAAGGGATGCAG No data
Right 1010311215 6:74388241-74388263 GACTCTTTAGGAAAAATTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010311211 Original CRISPR CTGCATCCCTTGAATAATTA AGG (reversed) Intergenic
No off target data available for this crispr