ID: 1010317424

View in Genome Browser
Species Human (GRCh38)
Location 6:74467147-74467169
Sequence TCCCAGACACTAGTGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010317424_1010317430 14 Left 1010317424 6:74467147-74467169 CCCTTCTCCACTAGTGTCTGGGA No data
Right 1010317430 6:74467184-74467206 CCTGGTTCTCAGCAAAACCAGGG No data
1010317424_1010317428 13 Left 1010317424 6:74467147-74467169 CCCTTCTCCACTAGTGTCTGGGA No data
Right 1010317428 6:74467183-74467205 TCCTGGTTCTCAGCAAAACCAGG No data
1010317424_1010317427 -4 Left 1010317424 6:74467147-74467169 CCCTTCTCCACTAGTGTCTGGGA No data
Right 1010317427 6:74467166-74467188 GGGAGTCAAGAATCAAGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010317424 Original CRISPR TCCCAGACACTAGTGGAGAA GGG (reversed) Intergenic
No off target data available for this crispr