ID: 1010318416 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:74477731-74477753 |
| Sequence | TCTACCAGGGTGGTGGTCTC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1010318416_1010318423 | 8 | Left | 1010318416 | 6:74477731-74477753 | CCTGAGACCACCACCCTGGTAGA | No data | ||
| Right | 1010318423 | 6:74477762-74477784 | GCAGCAGACAGACCACACAAAGG | No data | ||||
| 1010318416_1010318424 | 11 | Left | 1010318416 | 6:74477731-74477753 | CCTGAGACCACCACCCTGGTAGA | No data | ||
| Right | 1010318424 | 6:74477765-74477787 | GCAGACAGACCACACAAAGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1010318416 | Original CRISPR | TCTACCAGGGTGGTGGTCTC AGG (reversed) | Intergenic | ||