ID: 1010318421

View in Genome Browser
Species Human (GRCh38)
Location 6:74477744-74477766
Sequence GCTGCTGACCACCTCTACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010318421_1010318424 -2 Left 1010318421 6:74477744-74477766 CCCTGGTAGAGGTGGTCAGCAGC No data
Right 1010318424 6:74477765-74477787 GCAGACAGACCACACAAAGGTGG No data
1010318421_1010318423 -5 Left 1010318421 6:74477744-74477766 CCCTGGTAGAGGTGGTCAGCAGC No data
Right 1010318423 6:74477762-74477784 GCAGCAGACAGACCACACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010318421 Original CRISPR GCTGCTGACCACCTCTACCA GGG (reversed) Intergenic