ID: 1010318422

View in Genome Browser
Species Human (GRCh38)
Location 6:74477745-74477767
Sequence TGCTGCTGACCACCTCTACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010318422_1010318424 -3 Left 1010318422 6:74477745-74477767 CCTGGTAGAGGTGGTCAGCAGCA No data
Right 1010318424 6:74477765-74477787 GCAGACAGACCACACAAAGGTGG No data
1010318422_1010318423 -6 Left 1010318422 6:74477745-74477767 CCTGGTAGAGGTGGTCAGCAGCA No data
Right 1010318423 6:74477762-74477784 GCAGCAGACAGACCACACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010318422 Original CRISPR TGCTGCTGACCACCTCTACC AGG (reversed) Intergenic