ID: 1010318423

View in Genome Browser
Species Human (GRCh38)
Location 6:74477762-74477784
Sequence GCAGCAGACAGACCACACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010318416_1010318423 8 Left 1010318416 6:74477731-74477753 CCTGAGACCACCACCCTGGTAGA No data
Right 1010318423 6:74477762-74477784 GCAGCAGACAGACCACACAAAGG No data
1010318420_1010318423 -2 Left 1010318420 6:74477741-74477763 CCACCCTGGTAGAGGTGGTCAGC No data
Right 1010318423 6:74477762-74477784 GCAGCAGACAGACCACACAAAGG No data
1010318422_1010318423 -6 Left 1010318422 6:74477745-74477767 CCTGGTAGAGGTGGTCAGCAGCA No data
Right 1010318423 6:74477762-74477784 GCAGCAGACAGACCACACAAAGG No data
1010318419_1010318423 1 Left 1010318419 6:74477738-74477760 CCACCACCCTGGTAGAGGTGGTC No data
Right 1010318423 6:74477762-74477784 GCAGCAGACAGACCACACAAAGG No data
1010318421_1010318423 -5 Left 1010318421 6:74477744-74477766 CCCTGGTAGAGGTGGTCAGCAGC No data
Right 1010318423 6:74477762-74477784 GCAGCAGACAGACCACACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010318423 Original CRISPR GCAGCAGACAGACCACACAA AGG Intergenic