ID: 1010320587

View in Genome Browser
Species Human (GRCh38)
Location 6:74504496-74504518
Sequence GCAGCCAGCACAACTGATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010320587_1010320588 12 Left 1010320587 6:74504496-74504518 CCAGTATCAGTTGTGCTGGCTGC No data
Right 1010320588 6:74504531-74504553 ATCACCCCTCTCCCAACACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010320587 Original CRISPR GCAGCCAGCACAACTGATAC TGG (reversed) Intergenic
No off target data available for this crispr