ID: 1010320626

View in Genome Browser
Species Human (GRCh38)
Location 6:74504719-74504741
Sequence GATTCCCTACTGGCTTGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010320626_1010320630 -10 Left 1010320626 6:74504719-74504741 CCACCTCAAGCCAGTAGGGAATC No data
Right 1010320630 6:74504732-74504754 GTAGGGAATCTGCTGCCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010320626 Original CRISPR GATTCCCTACTGGCTTGAGG TGG (reversed) Intergenic
No off target data available for this crispr