ID: 1010323359

View in Genome Browser
Species Human (GRCh38)
Location 6:74538959-74538981
Sequence TCTGTAAACTGCCTCAAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010323359_1010323361 -1 Left 1010323359 6:74538959-74538981 CCAGACTTGAGGCAGTTTACAGA No data
Right 1010323361 6:74538981-74539003 ACCCGGAACCCCTTGAATGAAGG No data
1010323359_1010323367 8 Left 1010323359 6:74538959-74538981 CCAGACTTGAGGCAGTTTACAGA No data
Right 1010323367 6:74538990-74539012 CCCTTGAATGAAGGTGAGGCAGG No data
1010323359_1010323364 4 Left 1010323359 6:74538959-74538981 CCAGACTTGAGGCAGTTTACAGA No data
Right 1010323364 6:74538986-74539008 GAACCCCTTGAATGAAGGTGAGG No data
1010323359_1010323370 23 Left 1010323359 6:74538959-74538981 CCAGACTTGAGGCAGTTTACAGA No data
Right 1010323370 6:74539005-74539027 GAGGCAGGTCTCCATGAGGAAGG No data
1010323359_1010323369 19 Left 1010323359 6:74538959-74538981 CCAGACTTGAGGCAGTTTACAGA No data
Right 1010323369 6:74539001-74539023 AGGTGAGGCAGGTCTCCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010323359 Original CRISPR TCTGTAAACTGCCTCAAGTC TGG (reversed) Intergenic
No off target data available for this crispr