ID: 1010323363

View in Genome Browser
Species Human (GRCh38)
Location 6:74538983-74539005
Sequence CACCTTCATTCAAGGGGTTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010323363_1010323370 -1 Left 1010323363 6:74538983-74539005 CCGGAACCCCTTGAATGAAGGTG No data
Right 1010323370 6:74539005-74539027 GAGGCAGGTCTCCATGAGGAAGG No data
1010323363_1010323369 -5 Left 1010323363 6:74538983-74539005 CCGGAACCCCTTGAATGAAGGTG No data
Right 1010323369 6:74539001-74539023 AGGTGAGGCAGGTCTCCATGAGG No data
1010323363_1010323374 24 Left 1010323363 6:74538983-74539005 CCGGAACCCCTTGAATGAAGGTG No data
Right 1010323374 6:74539030-74539052 CCCACTACATTACCAACAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010323363 Original CRISPR CACCTTCATTCAAGGGGTTC CGG (reversed) Intergenic
No off target data available for this crispr