ID: 1010323370

View in Genome Browser
Species Human (GRCh38)
Location 6:74539005-74539027
Sequence GAGGCAGGTCTCCATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010323363_1010323370 -1 Left 1010323363 6:74538983-74539005 CCGGAACCCCTTGAATGAAGGTG No data
Right 1010323370 6:74539005-74539027 GAGGCAGGTCTCCATGAGGAAGG No data
1010323366_1010323370 -8 Left 1010323366 6:74538990-74539012 CCCTTGAATGAAGGTGAGGCAGG No data
Right 1010323370 6:74539005-74539027 GAGGCAGGTCTCCATGAGGAAGG No data
1010323359_1010323370 23 Left 1010323359 6:74538959-74538981 CCAGACTTGAGGCAGTTTACAGA No data
Right 1010323370 6:74539005-74539027 GAGGCAGGTCTCCATGAGGAAGG No data
1010323365_1010323370 -7 Left 1010323365 6:74538989-74539011 CCCCTTGAATGAAGGTGAGGCAG No data
Right 1010323370 6:74539005-74539027 GAGGCAGGTCTCCATGAGGAAGG No data
1010323368_1010323370 -9 Left 1010323368 6:74538991-74539013 CCTTGAATGAAGGTGAGGCAGGT No data
Right 1010323370 6:74539005-74539027 GAGGCAGGTCTCCATGAGGAAGG No data
1010323362_1010323370 0 Left 1010323362 6:74538982-74539004 CCCGGAACCCCTTGAATGAAGGT No data
Right 1010323370 6:74539005-74539027 GAGGCAGGTCTCCATGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010323370 Original CRISPR GAGGCAGGTCTCCATGAGGA AGG Intergenic
No off target data available for this crispr