ID: 1010323578

View in Genome Browser
Species Human (GRCh38)
Location 6:74540499-74540521
Sequence GACACCTCTTGGCCTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010323575_1010323578 11 Left 1010323575 6:74540465-74540487 CCATCTTCTGCAGATAACTACTC 0: 178
1: 192
2: 102
3: 110
4: 247
Right 1010323578 6:74540499-74540521 GACACCTCTTGGCCTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010323578 Original CRISPR GACACCTCTTGGCCTGTTAC TGG Intergenic
No off target data available for this crispr