ID: 1010324909

View in Genome Browser
Species Human (GRCh38)
Location 6:74553325-74553347
Sequence TTGAGAAAGCATGAGCAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010324909_1010324913 17 Left 1010324909 6:74553325-74553347 CCCACCTGCTCATGCTTTCTCAA No data
Right 1010324913 6:74553365-74553387 ATTATAGTATCTATTAAGGTTGG No data
1010324909_1010324912 13 Left 1010324909 6:74553325-74553347 CCCACCTGCTCATGCTTTCTCAA No data
Right 1010324912 6:74553361-74553383 TAAGATTATAGTATCTATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010324909 Original CRISPR TTGAGAAAGCATGAGCAGGT GGG (reversed) Intergenic
No off target data available for this crispr