ID: 1010325329

View in Genome Browser
Species Human (GRCh38)
Location 6:74556589-74556611
Sequence GACATCTCTTGGCCTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010325329_1010325333 11 Left 1010325329 6:74556589-74556611 CCAGTAACAGGCCAAGAGATGTC No data
Right 1010325333 6:74556623-74556645 GAGTAGTTATCTTCAGAGGATGG No data
1010325329_1010325332 7 Left 1010325329 6:74556589-74556611 CCAGTAACAGGCCAAGAGATGTC No data
Right 1010325332 6:74556619-74556641 AGGAGAGTAGTTATCTTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010325329 Original CRISPR GACATCTCTTGGCCTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr