ID: 1010335002

View in Genome Browser
Species Human (GRCh38)
Location 6:74670529-74670551
Sequence AACCCAAGACTATTGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010335000_1010335002 7 Left 1010335000 6:74670499-74670521 CCAGACTCACAGGTTTAGACTTT No data
Right 1010335002 6:74670529-74670551 AACCCAAGACTATTGGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010335002 Original CRISPR AACCCAAGACTATTGGAGAA AGG Intergenic
No off target data available for this crispr