ID: 1010340096

View in Genome Browser
Species Human (GRCh38)
Location 6:74740250-74740272
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010340089_1010340096 2 Left 1010340089 6:74740225-74740247 CCTTTCAAAGAGCACAGTATAGA No data
Right 1010340096 6:74740250-74740272 TTCAGGAGGGGGAAGTAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010340096 Original CRISPR TTCAGGAGGGGGAAGTAGAA GGG Intergenic
No off target data available for this crispr