ID: 1010342808

View in Genome Browser
Species Human (GRCh38)
Location 6:74776238-74776260
Sequence CAGTAGGGACAGATGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010342808_1010342814 1 Left 1010342808 6:74776238-74776260 CCTGCCTCCATCTGTCCCTACTG No data
Right 1010342814 6:74776262-74776284 CCTCACTCTTCATTTCTTCTTGG No data
1010342808_1010342815 2 Left 1010342808 6:74776238-74776260 CCTGCCTCCATCTGTCCCTACTG No data
Right 1010342815 6:74776263-74776285 CTCACTCTTCATTTCTTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010342808 Original CRISPR CAGTAGGGACAGATGGAGGC AGG (reversed) Intergenic
No off target data available for this crispr