ID: 1010347354

View in Genome Browser
Species Human (GRCh38)
Location 6:74827040-74827062
Sequence GTAGTCCAACTCTTCATTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010347352_1010347354 1 Left 1010347352 6:74827016-74827038 CCTGCGAGAAAGCTCGGAGATAA No data
Right 1010347354 6:74827040-74827062 GTAGTCCAACTCTTCATTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010347354 Original CRISPR GTAGTCCAACTCTTCATTTT GGG Intergenic
No off target data available for this crispr