ID: 1010350102

View in Genome Browser
Species Human (GRCh38)
Location 6:74863417-74863439
Sequence GTGCTTGTGCCCACATGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010350102_1010350107 -7 Left 1010350102 6:74863417-74863439 CCCCAGCATGTGGGCACAAGCAC No data
Right 1010350107 6:74863433-74863455 CAAGCACTGGAGATTAGAGAGGG No data
1010350102_1010350106 -8 Left 1010350102 6:74863417-74863439 CCCCAGCATGTGGGCACAAGCAC No data
Right 1010350106 6:74863432-74863454 ACAAGCACTGGAGATTAGAGAGG No data
1010350102_1010350108 3 Left 1010350102 6:74863417-74863439 CCCCAGCATGTGGGCACAAGCAC No data
Right 1010350108 6:74863443-74863465 AGATTAGAGAGGGAAAAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010350102 Original CRISPR GTGCTTGTGCCCACATGCTG GGG (reversed) Intergenic
No off target data available for this crispr