ID: 1010351305

View in Genome Browser
Species Human (GRCh38)
Location 6:74878280-74878302
Sequence CTGTTAATTAGGAGCCTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010351305_1010351313 2 Left 1010351305 6:74878280-74878302 CCTTGTAGGCTCCTAATTAACAG No data
Right 1010351313 6:74878305-74878327 GGTGGAGACAGAGGGGAAATAGG No data
1010351305_1010351312 -5 Left 1010351305 6:74878280-74878302 CCTTGTAGGCTCCTAATTAACAG No data
Right 1010351312 6:74878298-74878320 AACAGAGGGTGGAGACAGAGGGG No data
1010351305_1010351310 -7 Left 1010351305 6:74878280-74878302 CCTTGTAGGCTCCTAATTAACAG No data
Right 1010351310 6:74878296-74878318 TTAACAGAGGGTGGAGACAGAGG No data
1010351305_1010351311 -6 Left 1010351305 6:74878280-74878302 CCTTGTAGGCTCCTAATTAACAG No data
Right 1010351311 6:74878297-74878319 TAACAGAGGGTGGAGACAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010351305 Original CRISPR CTGTTAATTAGGAGCCTACA AGG (reversed) Intergenic
No off target data available for this crispr