ID: 1010354439

View in Genome Browser
Species Human (GRCh38)
Location 6:74915025-74915047
Sequence GGGAGCTGGAAAATAAATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010354439_1010354444 5 Left 1010354439 6:74915025-74915047 CCCTGATTTATTTTCCAGCTCCC No data
Right 1010354444 6:74915053-74915075 CTTTCCCATGTTGTGCCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010354439 Original CRISPR GGGAGCTGGAAAATAAATCA GGG (reversed) Intergenic
No off target data available for this crispr