ID: 1010355581

View in Genome Browser
Species Human (GRCh38)
Location 6:74928691-74928713
Sequence CTTCTTCCTGCAACCTAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010355575_1010355581 22 Left 1010355575 6:74928646-74928668 CCTTCATTTGGCTAAGGGACTGT No data
Right 1010355581 6:74928691-74928713 CTTCTTCCTGCAACCTAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010355581 Original CRISPR CTTCTTCCTGCAACCTAAGG AGG Intergenic
No off target data available for this crispr