ID: 1010357101

View in Genome Browser
Species Human (GRCh38)
Location 6:74947194-74947216
Sequence CTGTGTAAACCGAAGAAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010357101_1010357103 -6 Left 1010357101 6:74947194-74947216 CCTAGCTTCTTCGGTTTACACAG No data
Right 1010357103 6:74947211-74947233 ACACAGAACTTGGTTGAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010357101 Original CRISPR CTGTGTAAACCGAAGAAGCT AGG (reversed) Intergenic
No off target data available for this crispr