ID: 1010357372 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:74949541-74949563 |
| Sequence | GCTGAGAGTTCTGGTGTTTA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1010357372_1010357378 | 6 | Left | 1010357372 | 6:74949541-74949563 | CCCTAAACACCAGAACTCTCAGC | No data | ||
| Right | 1010357378 | 6:74949570-74949592 | CAAGATTCCCACCTTCATATTGG | No data | ||||
| 1010357372_1010357379 | 12 | Left | 1010357372 | 6:74949541-74949563 | CCCTAAACACCAGAACTCTCAGC | No data | ||
| Right | 1010357379 | 6:74949576-74949598 | TCCCACCTTCATATTGGTGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1010357372 | Original CRISPR | GCTGAGAGTTCTGGTGTTTA GGG (reversed) | Intergenic | ||