ID: 1010357372

View in Genome Browser
Species Human (GRCh38)
Location 6:74949541-74949563
Sequence GCTGAGAGTTCTGGTGTTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010357372_1010357379 12 Left 1010357372 6:74949541-74949563 CCCTAAACACCAGAACTCTCAGC No data
Right 1010357379 6:74949576-74949598 TCCCACCTTCATATTGGTGCAGG No data
1010357372_1010357378 6 Left 1010357372 6:74949541-74949563 CCCTAAACACCAGAACTCTCAGC No data
Right 1010357378 6:74949570-74949592 CAAGATTCCCACCTTCATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010357372 Original CRISPR GCTGAGAGTTCTGGTGTTTA GGG (reversed) Intergenic