ID: 1010357373

View in Genome Browser
Species Human (GRCh38)
Location 6:74949542-74949564
Sequence GGCTGAGAGTTCTGGTGTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010357373_1010357378 5 Left 1010357373 6:74949542-74949564 CCTAAACACCAGAACTCTCAGCC No data
Right 1010357378 6:74949570-74949592 CAAGATTCCCACCTTCATATTGG No data
1010357373_1010357379 11 Left 1010357373 6:74949542-74949564 CCTAAACACCAGAACTCTCAGCC No data
Right 1010357379 6:74949576-74949598 TCCCACCTTCATATTGGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010357373 Original CRISPR GGCTGAGAGTTCTGGTGTTT AGG (reversed) Intergenic