ID: 1010357378

View in Genome Browser
Species Human (GRCh38)
Location 6:74949570-74949592
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010357373_1010357378 5 Left 1010357373 6:74949542-74949564 CCTAAACACCAGAACTCTCAGCC No data
Right 1010357378 6:74949570-74949592 CAAGATTCCCACCTTCATATTGG No data
1010357375_1010357378 -3 Left 1010357375 6:74949550-74949572 CCAGAACTCTCAGCCTAGGCCAA No data
Right 1010357378 6:74949570-74949592 CAAGATTCCCACCTTCATATTGG No data
1010357372_1010357378 6 Left 1010357372 6:74949541-74949563 CCCTAAACACCAGAACTCTCAGC No data
Right 1010357378 6:74949570-74949592 CAAGATTCCCACCTTCATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010357378 Original CRISPR CAAGATTCCCACCTTCATAT TGG Intergenic