ID: 1010360633

View in Genome Browser
Species Human (GRCh38)
Location 6:74988456-74988478
Sequence CTATTTCTGGATCTTATTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010360633_1010360635 -3 Left 1010360633 6:74988456-74988478 CCAGAAATAAGATCCAGAAATAG No data
Right 1010360635 6:74988476-74988498 TAGACTAAAAACAGACTGAGAGG No data
1010360633_1010360637 27 Left 1010360633 6:74988456-74988478 CCAGAAATAAGATCCAGAAATAG No data
Right 1010360637 6:74988506-74988528 GATTTTAGAGTTCTCATACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010360633 Original CRISPR CTATTTCTGGATCTTATTTC TGG (reversed) Intergenic
No off target data available for this crispr