ID: 1010363439

View in Genome Browser
Species Human (GRCh38)
Location 6:75021966-75021988
Sequence ATGCTGTTATATGTAATACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010363435_1010363439 24 Left 1010363435 6:75021919-75021941 CCTTTTTGTTTGGAACACAGCAG No data
Right 1010363439 6:75021966-75021988 ATGCTGTTATATGTAATACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010363439 Original CRISPR ATGCTGTTATATGTAATACA AGG Intergenic
No off target data available for this crispr