ID: 1010368782

View in Genome Browser
Species Human (GRCh38)
Location 6:75083443-75083465
Sequence CAAAATAAACTGATGGAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010368778_1010368782 -1 Left 1010368778 6:75083421-75083443 CCCCAATGAATCAGAAACTAATC No data
Right 1010368782 6:75083443-75083465 CAAAATAAACTGATGGAACTTGG No data
1010368780_1010368782 -3 Left 1010368780 6:75083423-75083445 CCAATGAATCAGAAACTAATCAA No data
Right 1010368782 6:75083443-75083465 CAAAATAAACTGATGGAACTTGG No data
1010368779_1010368782 -2 Left 1010368779 6:75083422-75083444 CCCAATGAATCAGAAACTAATCA No data
Right 1010368782 6:75083443-75083465 CAAAATAAACTGATGGAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010368782 Original CRISPR CAAAATAAACTGATGGAACT TGG Intergenic
No off target data available for this crispr