ID: 1010368782 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:75083443-75083465 |
Sequence | CAAAATAAACTGATGGAACT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1010368778_1010368782 | -1 | Left | 1010368778 | 6:75083421-75083443 | CCCCAATGAATCAGAAACTAATC | No data | ||
Right | 1010368782 | 6:75083443-75083465 | CAAAATAAACTGATGGAACTTGG | No data | ||||
1010368780_1010368782 | -3 | Left | 1010368780 | 6:75083423-75083445 | CCAATGAATCAGAAACTAATCAA | No data | ||
Right | 1010368782 | 6:75083443-75083465 | CAAAATAAACTGATGGAACTTGG | No data | ||||
1010368779_1010368782 | -2 | Left | 1010368779 | 6:75083422-75083444 | CCCAATGAATCAGAAACTAATCA | No data | ||
Right | 1010368782 | 6:75083443-75083465 | CAAAATAAACTGATGGAACTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1010368782 | Original CRISPR | CAAAATAAACTGATGGAACT TGG | Intergenic | ||
No off target data available for this crispr |