ID: 1010369005

View in Genome Browser
Species Human (GRCh38)
Location 6:75085758-75085780
Sequence GGCTCCTAGAAACTGAACTC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 159}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010368996_1010369005 30 Left 1010368996 6:75085705-75085727 CCTCAATTCAAAGAACAACTTGG 0: 1
1: 1
2: 1
3: 13
4: 199
Right 1010369005 6:75085758-75085780 GGCTCCTAGAAACTGAACTCGGG 0: 1
1: 0
2: 1
3: 8
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010369005 Original CRISPR GGCTCCTAGAAACTGAACTC GGG Exonic
900266632 1:1760431-1760453 GGCTCCTGGGACCTGAACTTCGG + Intronic
901305811 1:8232040-8232062 GGCTCCTAGACCCAGATCTCAGG + Intergenic
901651209 1:10744219-10744241 GCTTCCTAGAAACTGAATTCTGG - Intronic
901805487 1:11736146-11736168 GGCTCCTAGGCTCCGAACTCGGG - Exonic
901814568 1:11786958-11786980 GGCCTCTAGAAACTAAACGCTGG + Exonic
902230792 1:15026190-15026212 GCCTCCTAGAGCCTGAGCTCAGG + Intronic
902616888 1:17628686-17628708 GGGTCCTAGAAGCAGAACTAAGG + Intronic
903256603 1:22106443-22106465 GGCACCTAGACTCAGAACTCTGG - Intergenic
907488850 1:54795930-54795952 GGCTGACAGGAACTGAACTCAGG - Intronic
914242804 1:145863449-145863471 GGCTCCTGGAAACTGATTCCAGG - Intergenic
916313628 1:163423733-163423755 GGCTCCTAGAGGCTGTTCTCAGG - Intergenic
1065137137 10:22682746-22682768 GGCTCCTAGACTCTCTACTCAGG + Intronic
1065981712 10:30904304-30904326 GGCTCCCAGACACTGGACTTTGG - Intronic
1066610100 10:37236066-37236088 GGCTGGAAGAAACTGAAATCAGG - Intronic
1068895338 10:62192706-62192728 AGCTCCTAGAAACTGTGCTCCGG - Intronic
1069490731 10:68858231-68858253 AGCTCCTAGAAGCAGAAGTCGGG + Intronic
1070183226 10:74034727-74034749 GCCTCTTAAACACTGAACTCTGG + Intronic
1070785442 10:79159768-79159790 GGGTGCTAGAATTTGAACTCAGG - Intronic
1072496290 10:95963382-95963404 GGTACCTAGACACTGAGCTCAGG + Intronic
1073894835 10:108143289-108143311 GGCTCCTAGCAACTGAGTTCTGG + Intergenic
1074430182 10:113387611-113387633 GGCTCCTAGGAAATAAACTCTGG - Intergenic
1075021459 10:118955713-118955735 AGCTCCTAAGAACTGAACCCTGG - Intergenic
1077220790 11:1415041-1415063 TGCTCCCAGGAACTGAGCTCAGG - Intronic
1077509488 11:2949367-2949389 GGCTGCAAGATACTGAACTCGGG + Intronic
1077799228 11:5521823-5521845 TGTTCTTAAAAACTGAACTCTGG + Intronic
1078940637 11:16001239-16001261 CTATCCTAGAAACTGACCTCTGG - Intronic
1083176410 11:60952584-60952606 GGTTCCTGGTAACTGAACTAGGG + Intergenic
1084257681 11:67954310-67954332 GTCACCTGGACACTGAACTCAGG - Intergenic
1086558828 11:88143780-88143802 GCCTTCTACAAACTGAACTATGG + Intronic
1086958885 11:92961945-92961967 GGGTCCAAGACACTGAATTCAGG + Intergenic
1087383388 11:97438031-97438053 GGCTCCTGGACACTGACCTTTGG + Intergenic
1088220255 11:107563133-107563155 GGCTCCTAGGAAAGGAACTGAGG + Intronic
1088544151 11:110942989-110943011 TGCTCCTAGAAGGTGAACTTGGG - Intergenic
1090261476 11:125323975-125323997 GGATGCTAGGAACTGAGCTCCGG - Intronic
1092427919 12:8389132-8389154 GTCACCTGGACACTGAACTCAGG - Intergenic
1092429186 12:8396119-8396141 GTCACCTGGACACTGAACTCAGG - Intergenic
1093574097 12:20706454-20706476 GGCTGCTAGACAATTAACTCAGG + Intronic
1093743659 12:22715566-22715588 AGCTCCTAGAGACTGCCCTCAGG - Intergenic
1098076839 12:66740443-66740465 TTCTCCTAGAATCTGAACTGTGG + Intronic
1100427876 12:94504044-94504066 GCCTCCTAGAAACTGATCAAGGG - Intergenic
1104561358 12:129847977-129847999 GGCTCCAAGAACCTGAAATGGGG + Intronic
1105409985 13:20163521-20163543 GGCTGCTAGAAAGTGAATTGAGG - Intergenic
1106758940 13:32849091-32849113 GGTTCCTAGAAAGCAAACTCTGG - Intergenic
1112134577 13:96562794-96562816 GGCTCCTAGATCCTGACTTCTGG - Intronic
1112421293 13:99251801-99251823 GTCATCTAGAAACTGAGCTCAGG - Intronic
1112583185 13:100694090-100694112 GGATCCCAGACACTGACCTCAGG + Intergenic
1114194548 14:20465694-20465716 GGCTCCTAGAAAGGGAAGCCAGG - Intergenic
1114981084 14:28165608-28165630 TGTACTTAGAAACTGAACTCTGG - Intergenic
1122192559 14:100057771-100057793 GACTCCTAGAACCTCAACTATGG - Intronic
1124509546 15:30311660-30311682 GGCCCCTAGAAACTTCACTGAGG - Intergenic
1124734014 15:32227002-32227024 GGCCCCTAGAAACTTCACTGAGG + Intergenic
1125294555 15:38188269-38188291 GAGTCCTAGAAATTGAATTCTGG - Intergenic
1130467416 15:84199581-84199603 GGCTCCGAGATGATGAACTCCGG - Intergenic
1130496844 15:84473954-84473976 GGCTCCGAGATGATGAACTCCGG + Intergenic
1130589711 15:85204179-85204201 GGCTCCGAGATGATGAACTCCGG - Intergenic
1133314650 16:4875185-4875207 GGCTCCCAGAAACAGAACTCTGG - Exonic
1134681418 16:16128447-16128469 TGCTTTTAAAAACTGAACTCAGG - Intronic
1134747039 16:16596424-16596446 GGCTCCTAAAAACCGAAGACTGG - Intergenic
1135830629 16:25769749-25769771 CGCTCCTAGATAATGAACGCAGG + Intronic
1136640772 16:31563452-31563474 GTCTCCTAGAGACTGAGATCTGG + Intergenic
1136664193 16:31793860-31793882 GTCTCCTAGAGACTGAGATCTGG - Intronic
1139391225 16:66607036-66607058 GGCTACTAGAATTTGAACCCAGG - Intronic
1142103282 16:88286871-88286893 GACTCCCAGATACTGAGCTCTGG + Intergenic
1144269333 17:13601687-13601709 GGCTGAGAGAACCTGAACTCGGG - Exonic
1144661152 17:17071818-17071840 GGCTGCTTGAAACAGGACTCGGG + Intronic
1147782827 17:42956031-42956053 GGATCCTAGAACCTGAAGGCAGG + Intronic
1147964285 17:44185743-44185765 GGCTTCTACCAACTGAACACTGG - Intergenic
1149446355 17:56716257-56716279 GTGTCCAAGAAACTGAACACTGG + Intergenic
1150559472 17:66282206-66282228 GCCTCCTAGATACTGCCCTCTGG - Intergenic
1151812623 17:76453277-76453299 GGCTCCTAGCAACTGCATCCCGG - Intergenic
1154111608 18:11573317-11573339 GGCTCCCAGAAACTTCACTCTGG - Intergenic
1155422469 18:25669892-25669914 GTCTTCTAGAAACTTATCTCTGG - Intergenic
1156677861 18:39552573-39552595 GCTTCCAAGAAAGTGAACTCAGG + Intergenic
1162441161 19:10692958-10692980 GGCTTCAAGAAGCTGAAGTCAGG + Intergenic
1164977163 19:32581663-32581685 GGGTCATAACAACTGAACTCCGG - Intronic
1168027143 19:53650804-53650826 GGTTCCTAGAAGCTCTACTCTGG - Intergenic
930416032 2:51092634-51092656 TGTTCCTAGAAACTGATCCCAGG + Intergenic
933069472 2:77839030-77839052 GGATTGTAGAATCTGAACTCTGG + Intergenic
935317759 2:101853773-101853795 GGATCCTAGAAGCTGAAGTTGGG + Intronic
935465825 2:103397039-103397061 AGCTCATGAAAACTGAACTCAGG + Intergenic
936318026 2:111442424-111442446 AGCTCCTAGTAAATGAAGTCTGG - Intergenic
936635787 2:114255967-114255989 TGCACCTAGACACTGTACTCTGG - Intergenic
939622021 2:144431894-144431916 ACCTCCTAAAAACTGATCTCTGG + Intronic
940793571 2:158053436-158053458 GACTGCTTGAAATTGAACTCTGG - Intronic
944977450 2:205071349-205071371 TGGTCCTAGAAACCAAACTCCGG + Intronic
946517453 2:220429026-220429048 GGCTACTGGAGACTGAATTCTGG - Intergenic
947191924 2:227515382-227515404 GGATGCTTGAAACTGAAATCTGG - Intronic
1170033081 20:11962581-11962603 GGCTAATAGAAACTTAAGTCAGG + Intergenic
1170218425 20:13916455-13916477 GGCTCATAGAAAGAGATCTCAGG - Intronic
1170977155 20:21175708-21175730 GCCTCCTAGAGACTTAACTAAGG - Intronic
1171249440 20:23637371-23637393 GGCTCCTGGAAGCTGATCTTAGG + Intronic
1172933201 20:38600702-38600724 GGCCCCAAGAAACTGAAAACAGG - Intergenic
1180212746 21:46305004-46305026 GACTCATAGAAACAGAACACAGG + Intronic
953483916 3:43276438-43276460 AGCTTCTAGAAGCTGCACTCTGG + Intergenic
955544715 3:60015907-60015929 TGCTCCTAGAAAAACAACTCAGG + Intronic
955581426 3:60427225-60427247 AGCTCCTAGAAGCTGCTCTCAGG - Intronic
956608855 3:71101387-71101409 GGATCAAAGAAACTGAACTTGGG + Intronic
956655519 3:71546726-71546748 GGCTCCTGGACAGTGAAGTCAGG + Intronic
957072615 3:75578798-75578820 GTCACCTGGACACTGAACTCAGG - Intergenic
957238270 3:77623257-77623279 AGCTACTACAAACTGAAGTCTGG + Intronic
960572498 3:119199057-119199079 GGCTGCTATGAACTGATCTCTGG + Exonic
961872908 3:130001625-130001647 GTCACCTGGACACTGAACTCAGG - Intergenic
965279077 3:166725009-166725031 GGCTGCTAGAAGCTGTACTTCGG + Intergenic
966346058 3:178981564-178981586 GGCCCCTAGGAAGAGAACTCAGG + Intergenic
969016215 4:4106133-4106155 GTCACCTGGACACTGAACTCAGG - Intergenic
969737734 4:9002215-9002237 GTCACCTGGACACTGAACTCAGG + Intergenic
969796937 4:9533776-9533798 GTCACCTGGACACTGAACTCAGG + Intergenic
972262896 4:37428570-37428592 AGCTACTAAAAACTAAACTCTGG - Intronic
973693068 4:53460070-53460092 GCCTCCTAGAAACTACACTATGG - Intronic
978824067 4:112999948-112999970 GGCTCCTAGCCACTGAACTTAGG - Intronic
983014192 4:162589849-162589871 AGCTAAAAGAAACTGAACTCTGG + Intergenic
984927513 4:184819628-184819650 GGCTTCTAGAAAGCAAACTCTGG - Intronic
987219214 5:15772297-15772319 TGTTCCTGGAAACTGAACTGTGG + Intronic
992228787 5:74643126-74643148 ACCTCCTACAAACTGTACTCTGG + Intronic
994540751 5:101093154-101093176 GGATCCTAGAAGCTGAATGCTGG + Intergenic
997303954 5:132825272-132825294 GGCTCCATGAACCTGGACTCCGG - Exonic
999634053 5:153601655-153601677 GGCTCCTAGAATTTGTTCTCTGG - Intronic
1000043766 5:157504756-157504778 GTCTTCTAGCATCTGAACTCAGG - Intronic
1000802840 5:165750221-165750243 GTCTCTTAGAAACAGATCTCAGG - Intergenic
1001150808 5:169225829-169225851 GGCTCTTAGAAACCAAACTTTGG - Intronic
1002581265 5:180210701-180210723 GGCTCCGAGGAGCTGAGCTCAGG + Intergenic
1007413830 6:41680440-41680462 GCCTCCTAAAAACTAACCTCAGG - Intergenic
1008148983 6:47927146-47927168 GGCTCCAAGTAGCTGAGCTCAGG - Intronic
1010369005 6:75085758-75085780 GGCTCCTAGAAACTGAACTCGGG + Exonic
1011746207 6:90410232-90410254 GGCTCCTATAGCCTGAAATCAGG + Intergenic
1014159737 6:118154139-118154161 GGCTTCTAGCTACTGACCTCTGG - Intronic
1017136165 6:151149221-151149243 GGATTCTAGTCACTGAACTCTGG + Intergenic
1022043083 7:26599017-26599039 GGCTCTCAGAAACAGAAATCTGG - Intergenic
1026048425 7:66924144-66924166 TGCTCCTGCAAACTGAACACAGG - Intronic
1029986687 7:104929166-104929188 GTCTCCTTGAAACTCCACTCTGG + Intergenic
1030100342 7:105940357-105940379 GGCTCCTACAAACTGGACACAGG - Intronic
1032151713 7:129434732-129434754 GGGTCCTAGCGGCTGAACTCTGG + Intronic
1033921079 7:146392823-146392845 GACTCTTAGAAAATGACCTCAGG + Intronic
1034897448 7:154886558-154886580 GGCTCCGAGAACTTGAATTCAGG + Intronic
1036242832 8:7093476-7093498 GTCACCTGGACACTGAACTCAGG + Intergenic
1036257968 8:7220552-7220574 GTCACCTGGACACTGAACTCAGG - Intergenic
1036259217 8:7227550-7227572 GTCACCTGGACACTGAACTCAGG - Intergenic
1036307410 8:7611971-7611993 GTCACCTGGACACTGAACTCAGG + Intergenic
1036310017 8:7679148-7679170 GTCACCTGGACACTGAACTCAGG - Intergenic
1036311270 8:7686145-7686167 GTCACCTGGACACTGAACTCAGG - Intergenic
1036358254 8:8059955-8059977 GTCACCTGGACACTGAACTCAGG + Intergenic
1036359518 8:8066954-8066976 GTCACCTGGACACTGAACTCAGG + Intergenic
1036698391 8:10994182-10994204 GGCTCCTAAGAACTAAACCCTGG + Intronic
1036829897 8:12013668-12013690 GTCACCTGGACACTGAACTCAGG - Intronic
1036891438 8:12599998-12600020 GTCACCTGGACACTGAACTCAGG - Intergenic
1036892696 8:12606988-12607010 GTCACCTGGACACTGAACTCAGG - Intergenic
1036898990 8:12657960-12657982 GTCACCTGGACACTGAACTCAGG - Intergenic
1036900246 8:12664974-12664996 GTCACCTGGACACTGAACTCAGG - Intergenic
1040529768 8:48257266-48257288 TGCTCCTAGCAAGGGAACTCAGG + Intergenic
1041570668 8:59333670-59333692 GTCTCCTGGAAACAGAACTTCGG + Intergenic
1042667302 8:71221217-71221239 GGTTCCTAACAACTGAACTGTGG + Intronic
1043441410 8:80279786-80279808 GGCTCCGCAAAACTGCACTCAGG + Intergenic
1045601671 8:103723883-103723905 GGCTCCCCGACAGTGAACTCAGG - Intronic
1046178574 8:110611552-110611574 GGGTTCTAGAAACTGAAGTTTGG + Intergenic
1046615328 8:116471227-116471249 GGATGCTAGGAACTGAACCCTGG - Intergenic
1046634039 8:116652169-116652191 GGCTCCTAGGAAAGGATCTCAGG + Intronic
1054843928 9:69772432-69772454 GACTCCTAGAAACTTCACTAAGG + Intergenic
1056037124 9:82618463-82618485 GGCTCCCAGAAAATGAACAGAGG + Intergenic
1058175387 9:101729963-101729985 GGCTCTGAGGAACTAAACTCAGG - Intronic
1058741343 9:107945641-107945663 GGCACCCAGAAACTGACATCAGG - Intergenic
1058881765 9:109291539-109291561 GGCTCCTGGAAATTCAATTCTGG + Intronic
1061720928 9:132550896-132550918 GGTTCATTCAAACTGAACTCTGG + Intronic
1061736581 9:132664757-132664779 GCCTTCTAGAATCTGACCTCTGG + Intronic
1062230835 9:135480439-135480461 GGATCCCAGAAACATAACTCCGG + Intronic
1185714062 X:2327111-2327133 AGCTAATAGAAACTGAAATCTGG - Intronic
1187990014 X:24860197-24860219 GGCTTCTCAAAACTGTACTCTGG - Intronic
1189343477 X:40222381-40222403 AGCTGCAAGAAACTGAAGTCTGG + Intergenic
1191095769 X:56671614-56671636 GACTCCTAGAAACTTTACTGAGG + Intergenic
1200124514 X:153806974-153806996 GGGGCCTGGAAACTGAGCTCAGG - Intronic