ID: 1010369973

View in Genome Browser
Species Human (GRCh38)
Location 6:75096302-75096324
Sequence ATATAGATCTTTAGGTAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 183}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010369973 Original CRISPR ATATAGATCTTTAGGTAATG GGG (reversed) Intronic
902159704 1:14520106-14520128 AGAGAGATCTTCAGGAAATGAGG + Intergenic
908499923 1:64733003-64733025 ATGTAGATCCTTAGCTAGTGGGG - Intergenic
909007962 1:70299350-70299372 ATTTCACTCTTTAGGTAATGGGG + Intronic
909534288 1:76718618-76718640 ATATAGATTTTTTGCTATTGGGG + Intergenic
909786998 1:79625910-79625932 ATTTAGTTCATTATGTAATGTGG + Intergenic
911898912 1:103475457-103475479 GTATAGTTCTTTCTGTAATGGGG - Intergenic
913409773 1:118538294-118538316 ATATAGGTCTTTAAGAGATGAGG - Intergenic
913669817 1:121086634-121086656 AAAAAGATTTTTAGGTATTGTGG - Intergenic
914021580 1:143874032-143874054 AAAAAGATTTTTAGGTATTGTGG - Intergenic
914660068 1:149781983-149782005 AAAAAGATTTTTAGGTATTGTGG - Intergenic
919671745 1:200344644-200344666 ATGTAAATCTTGATGTAATGAGG + Intergenic
1063841776 10:10080633-10080655 ATCAACATCTTTAGGAAATGAGG + Intergenic
1064632882 10:17335206-17335228 ATACAGATTTTTAAGTAATACGG - Intronic
1068097309 10:52507957-52507979 ATATAATCCTTTAAGTAATGAGG - Intergenic
1068440140 10:57043310-57043332 ATATAGAGCTTAAGAAAATGTGG + Intergenic
1069177285 10:65308488-65308510 ATCTACATATTTAGGTACTGTGG + Intergenic
1070233049 10:74592446-74592468 ATATATATATTTAGGTTTTGAGG - Intronic
1070483724 10:76910227-76910249 AGATGGATCTTTGGGTAAGGGGG + Intronic
1070582307 10:77731441-77731463 ATTTACTTCTTTTGGTAATGGGG - Intergenic
1077379692 11:2224616-2224638 ATATTTCTCTCTAGGTAATGCGG - Intergenic
1078275093 11:9836298-9836320 ATATAGATCTATAGGTCAATGGG + Intronic
1078365282 11:10701287-10701309 ATATCAATATTTGGGTAATGTGG + Intergenic
1079001000 11:16756130-16756152 AAATGGATCTTTGGATAATGGGG + Exonic
1079340191 11:19605287-19605309 ATCTAGATCTTTTGGTTTTGGGG + Intronic
1081171752 11:39878146-39878168 ATAAATTACTTTAGGTAATGTGG - Intergenic
1085942893 11:81226708-81226730 ATATAGATCTTCAGGATGTGCGG + Intergenic
1086836354 11:91628483-91628505 ATATATTTCTTTAGAAAATGGGG - Intergenic
1087264894 11:96049879-96049901 ATAAACATCTTTAAGTAATTAGG - Intronic
1088092154 11:106055001-106055023 ATATAGTTCTTTAGGAGAAGGGG + Intronic
1090865218 11:130694065-130694087 ACACAGATTTTTAAGTAATGTGG + Intronic
1091202065 11:133788653-133788675 ATATAGATTTCTAGATAACGAGG - Intergenic
1093323473 12:17743115-17743137 ATATAGTTAATTAGTTAATGAGG + Intergenic
1093378966 12:18467859-18467881 AGATAGAGCTTTAGGTTATTGGG - Intronic
1093754540 12:22837852-22837874 ATTTAGATTTTTAGGTATTTAGG + Intergenic
1093968787 12:25355471-25355493 ATATAGATATTTTGGTAAGAGGG + Intergenic
1094334513 12:29333561-29333583 ATATTTATCTTCAGATAATGTGG + Intronic
1095301737 12:40592343-40592365 ATATATGACTTTAGGTATTGTGG + Intergenic
1095874907 12:47069439-47069461 ATCTAAATCTTTAGATAATGTGG + Intergenic
1098257613 12:68633301-68633323 ATATAAATCATTAGGGAATAGGG - Intronic
1099387641 12:82035836-82035858 AGAAAGATTTTTAGGTAAAGAGG - Intergenic
1100520517 12:95370811-95370833 ATATTGATCTTTTGGGATTGTGG + Intergenic
1100784177 12:98061772-98061794 CTTTAGAACTTTAAGTAATGTGG - Intergenic
1101307722 12:103546255-103546277 ATATAGATTTTTTGAAAATGAGG + Intergenic
1102286498 12:111661617-111661639 ATTTAAATCTTTGGGAAATGGGG - Intronic
1103229219 12:119314052-119314074 ATCTAGATCTTAAGGGAAAGAGG - Intergenic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1105446266 13:20460234-20460256 ATATACATATATATGTAATGTGG - Intronic
1105930228 13:25045703-25045725 ATATAGTCCTTCAGGTAGTGAGG + Intergenic
1106889171 13:34224737-34224759 AAATAAATCTGTAGGTAATCAGG + Intergenic
1107180596 13:37454574-37454596 ATATAGCTTTTTAGGGAATTTGG + Intergenic
1107591543 13:41912218-41912240 ATATAAATCTCCAAGTAATGTGG + Intronic
1109454770 13:62570677-62570699 ATATATATATATATGTAATGGGG + Intergenic
1109631302 13:65050386-65050408 ATACAGAGCTTTGTGTAATGTGG - Intergenic
1110320890 13:74158683-74158705 ATATAGAGTGTTGGGTAATGTGG + Intergenic
1110464453 13:75784731-75784753 ATATCCATCTTTAGGTTTTGTGG - Intronic
1111739564 13:92186819-92186841 AAGTAAATTTTTAGGTAATGTGG - Intronic
1112415133 13:99197927-99197949 CTACAGATCTTTAGTTTATGTGG + Intergenic
1114035179 14:18618235-18618257 ATATATATGTTTAGGTTATGAGG + Intergenic
1114123466 14:19696780-19696802 ATATATATGTTTAGGTTATGAGG - Intergenic
1114489289 14:23087688-23087710 TTTTAGTTCTATAGGTAATGGGG - Intronic
1115565290 14:34619996-34620018 ATATTGATCTTGAGGTCAGGTGG - Intronic
1116139513 14:40972993-40973015 ATAAAGATCTTTAGGAAAAATGG + Intergenic
1116555126 14:46293245-46293267 ATATTGATTCTTGGGTAATGAGG - Intergenic
1118460954 14:65986522-65986544 AGATAGAGCTGTAGGTAATATGG + Intronic
1120495400 14:85228311-85228333 AAATAAATATATAGGTAATGTGG - Intergenic
1125140863 15:36405898-36405920 ATATAGAGCTTCAAGTAATATGG + Intergenic
1127862447 15:63005576-63005598 ATATAACTCTTTAGGAAATTAGG - Intergenic
1129567299 15:76636335-76636357 ATAGAGATCTCTAGGGAATAAGG - Intronic
1129567755 15:76641582-76641604 ATTTAGATATTTTGGTATTGCGG - Intronic
1133392140 16:5419183-5419205 AGATAGATGTTTATGTAAAGGGG + Intergenic
1133626398 16:7574330-7574352 AAATAGATGTTTATGTAAAGGGG + Intronic
1133649038 16:7792241-7792263 ATATATATCTTTTTTTAATGAGG + Intergenic
1133876907 16:9743537-9743559 ATTTGGGTCTTTAGGCAATGGGG + Intergenic
1135297022 16:21289089-21289111 ATATATACCTTTAGGTCAGGTGG + Intronic
1139176126 16:64690223-64690245 ATATAGCTGATTAGGAAATGTGG + Intergenic
1143429745 17:6872314-6872336 ACATAGATCCTTAAGTAATCTGG + Intergenic
1145928785 17:28668914-28668936 ATAGAGATCTTGGGGTCATGGGG + Intronic
1154361185 18:13662576-13662598 ATATAACTTGTTAGGTAATGTGG - Intergenic
1155299970 18:24420110-24420132 ATATTGATTTTGAGGTTATGGGG + Intergenic
1156219344 18:35035943-35035965 ATATAGGTCTTAATGTGATGAGG - Intronic
1157027398 18:43861845-43861867 ATATTGATCATTAGGTCCTGAGG + Intergenic
1159201110 18:65185280-65185302 ATATAGATCATAAAGTAATATGG - Intergenic
1159288174 18:66379688-66379710 TGAGAGATCTTTAGGTCATGGGG - Intergenic
926473795 2:13296163-13296185 ATATCGATCTTTAGGTAAAGAGG + Intergenic
930842839 2:55866603-55866625 ATATATTTCTTTAGAAAATGGGG - Exonic
931616054 2:64159244-64159266 ATAAAGATCTCAAGGTAATTGGG - Intergenic
931643602 2:64402475-64402497 ATAAAGTTCTTTAGGGAAAGAGG - Intergenic
931924093 2:67052228-67052250 ATGTAGATCATCAGGAAATGGGG - Intergenic
933052823 2:77621127-77621149 ATAAATTTCTTTAGGTAATATGG - Intergenic
934635467 2:95984108-95984130 ATATAAATCCTTTGGTAATCGGG - Intronic
934798164 2:97121144-97121166 ATATAAATCCTTTGGTAATCGGG + Intronic
934835260 2:97582294-97582316 ATATAAATCCTTTGGTAATCGGG - Intronic
935507094 2:103919149-103919171 ATTTTGTTCTTTATGTAATGGGG - Intergenic
938276068 2:130024632-130024654 ATGTATATGTTTAGGTTATGAGG - Intergenic
938327028 2:130415388-130415410 ATGTATATGTTTAGGTTATGAGG - Intergenic
939374002 2:141340403-141340425 ACATAAATCTTTAGAAAATGAGG + Intronic
939781381 2:146452860-146452882 TTGTAGATCTATAGGTAATGGGG + Intergenic
942432393 2:175926278-175926300 ATGGAGATGTTTAGGTCATGAGG + Exonic
947410388 2:229831933-229831955 ATATAGGGCTTAAGGTATTGTGG - Intronic
947935671 2:234001556-234001578 ATTTAGATCTGTGGGTAGTGTGG - Intronic
1169332402 20:4726500-4726522 ATATATATTTTTAGCTAATAAGG - Exonic
1169967222 20:11231468-11231490 ATATAAATCTCTTAGTAATGTGG - Intergenic
1175471327 20:59231306-59231328 ATCTAGATCTCTAGCTCATGTGG - Intronic
1176900116 21:14430876-14430898 CTATAGTTCTTTGGGTAATGTGG - Intergenic
1178936958 21:36871302-36871324 ATTTACTTCTTTAGGTATTGGGG - Intronic
1180459298 22:15545281-15545303 ATATATATGTTTAGGTTATGAGG + Intergenic
1182395084 22:30029620-30029642 CTATTGATCTTTTGGGAATGAGG + Intronic
1184306730 22:43608067-43608089 ATTTCCATCTATAGGTAATGGGG + Intronic
949724313 3:7025751-7025773 AATGAGATCTTTGGGTAATGAGG - Intronic
949737513 3:7190948-7190970 ATATATATATTTATGTAAGGTGG - Intronic
949787310 3:7756195-7756217 ATATAGAACTTTGGGAAGTGTGG + Intergenic
956416658 3:69038027-69038049 ATATATATCCTTAGGTCATATGG - Intronic
957127845 3:76185235-76185257 ATATACATATTTATGTAATATGG + Intronic
958136889 3:89505413-89505435 ATGTATATCTTTAGCCAATGGGG + Intergenic
959122559 3:102249741-102249763 ATATATCTCATTAAGTAATGGGG + Intronic
959514901 3:107254325-107254347 ATATTCATCTTTTGGTAGTGTGG - Intergenic
959686904 3:109157424-109157446 GTATAGACCTTTAGGTTATAAGG + Intergenic
961104782 3:124231753-124231775 ACATAAATTTTTAGGGAATGAGG - Intronic
964045465 3:152319411-152319433 ATAAAGATCTTGAGGTCATTAGG + Intronic
964584153 3:158277017-158277039 ATATATATATTTAGGTTTTGTGG + Intronic
964616302 3:158670251-158670273 ATGAAGATCTTTCAGTAATGGGG - Intronic
967511392 3:190317609-190317631 ATATAGAACCTAAGGTAATATGG - Intronic
967813247 3:193778165-193778187 ATATCTATCTTTAGGTAGTAGGG + Intergenic
968243747 3:197119777-197119799 ATATAATTCTTTAAGTAATCTGG - Intronic
971062967 4:22993169-22993191 ATATAGTACTTTAGGTGATGAGG + Intergenic
971294897 4:25379324-25379346 ATCCAGATCTTTAAGGAATGAGG + Intronic
972942143 4:44208921-44208943 ATCTAAATCTGTAGGTAATAAGG + Intronic
974349445 4:60725209-60725231 ATATAGATCCTAAGGAATTGGGG + Intergenic
974447191 4:62000392-62000414 ATGTATTTCTTTAGGTAATGTGG + Intronic
976005843 4:80429573-80429595 TTATACATCTTTGGGTAATGTGG + Intronic
977064762 4:92301074-92301096 TTATAAAACTTTAGTTAATGAGG + Intronic
977907907 4:102499599-102499621 TTATCTATCTTTTGGTAATGGGG + Intergenic
978267572 4:106844689-106844711 ATATATATATATATGTAATGGGG + Intergenic
978663897 4:111159953-111159975 ATATATCACTTTAGGTAGTGTGG - Intergenic
978994161 4:115129682-115129704 ATATAGATATTTAGGCAATCTGG + Intergenic
979402821 4:120271210-120271232 TTGTACAACTTTAGGTAATGTGG + Intergenic
981075626 4:140588339-140588361 ATATTGACCTTGAGGGAATGAGG + Intergenic
981656917 4:147122019-147122041 ATATAGATCCTAAAGTAATAAGG - Intergenic
982526276 4:156483269-156483291 ATAAAGATTTTTAGATAATTTGG + Intergenic
983338361 4:166424789-166424811 TGACAGATATTTAGGTAATGAGG - Intergenic
983606529 4:169592727-169592749 CTATAGATATTTATTTAATGAGG + Intronic
985478591 5:93272-93294 ATGTAAATCTTCATGTAATGTGG + Intergenic
993370096 5:87082416-87082438 ATATACATGTTGAGCTAATGAGG - Intergenic
994225586 5:97248834-97248856 ATATAAATCTTTATGTCATAAGG + Intergenic
997046589 5:130326385-130326407 ATATACATCTTTAGGAAAGGTGG + Intergenic
998628491 5:143872546-143872568 ATGTAGATGTTTAGGCCATGGGG + Intergenic
1002393392 5:178934294-178934316 TTATAGATCTATAGTTACTGTGG + Intergenic
1003445870 6:6183959-6183981 ATAGTCATCATTAGGTAATGGGG + Intronic
1007864465 6:44953519-44953541 ATATAGATTTTTAGGCAAGCAGG - Intronic
1008068218 6:47073280-47073302 ACACAGATTTTTAGGTAATGTGG + Intergenic
1010369973 6:75096302-75096324 ATATAGATCTTTAGGTAATGGGG - Intronic
1010924912 6:81733069-81733091 ATCTAACTCTTAAGGTAATGAGG + Intronic
1012197722 6:96365099-96365121 ATAGATAGCTTTAGGTAGTGTGG - Intergenic
1012708569 6:102567328-102567350 ATATATAGCATTTGGTAATGAGG - Intergenic
1014006837 6:116429014-116429036 ATAAGGAAATTTAGGTAATGTGG + Intronic
1014210980 6:118707664-118707686 ATAGAAATTTTTAGGTAAAGTGG + Intronic
1015413885 6:132926572-132926594 ATATAGGTTTTGAGGTAATACGG + Intergenic
1015676656 6:135757995-135758017 ATATAGATCTTTTTGCATTGTGG + Intergenic
1016775327 6:147898516-147898538 ATACTGATCTTTTGGTAGTGAGG - Intergenic
1022089978 7:27101885-27101907 ATATATATTTTTAGGAAGTGGGG - Intronic
1024846019 7:53643269-53643291 ATATAAATCTTTATGTGGTGTGG - Intergenic
1025036379 7:55594807-55594829 ATATAGAGGTTTCGGCAATGAGG + Intergenic
1025232171 7:57210067-57210089 ATGTATATCTTGTGGTAATGGGG - Intergenic
1028387719 7:90276430-90276452 ATATAGATCCTAAAGTAATGGGG + Intronic
1028413630 7:90557628-90557650 AAAGAGGTCATTAGGTAATGAGG - Intronic
1028863408 7:95680225-95680247 ATATATATCTCCAGGTAATGTGG - Intergenic
1030690908 7:112532135-112532157 ACATGGATCTATAGTTAATGAGG - Intergenic
1030916503 7:115321092-115321114 ATATATATCAATATGTAATGTGG + Intergenic
1031092321 7:117374049-117374071 ATATAGATCTTGCTGTAATATGG + Intronic
1031181354 7:118420797-118420819 TTTTAGCTCTTTAGGTATTGTGG + Intergenic
1033111179 7:138578926-138578948 ATATATATATATAGGTCATGTGG + Intronic
1037849362 8:22314063-22314085 AGATAAATCTTTTGGTAATCAGG + Intronic
1038905155 8:31893301-31893323 ATATAGATTTTAAGGTTAAGTGG + Intronic
1039022259 8:33220663-33220685 ATATAAATCTTTAGCTCATTTGG - Intergenic
1041913079 8:63110560-63110582 ATATAGAACTTTAAGAAATTTGG - Intergenic
1042486032 8:69346650-69346672 ATATACATCTTTACAAAATGGGG - Intergenic
1044176054 8:89124001-89124023 ATAAAGATGTATAGGAAATGAGG + Intergenic
1044556998 8:93573780-93573802 ATATATATCTTTATCTAATTTGG - Intergenic
1047670907 8:127145803-127145825 ATCTTTTTCTTTAGGTAATGAGG - Intergenic
1047971607 8:130089284-130089306 AAATAGAACTTTGGGGAATGTGG + Intronic
1050095943 9:2066245-2066267 ATTTAAAACTTTATGTAATGAGG + Intronic
1052030001 9:23617889-23617911 AGATACATCTTTATATAATGAGG + Intergenic
1053918920 9:42969414-42969436 ATATACATTTTTATATAATGGGG - Intergenic
1054380257 9:64483196-64483218 ATATACATTTTTATATAATGGGG - Intergenic
1054957360 9:70928070-70928092 ATCTGGATATTTAGGTAATAGGG + Intronic
1055866571 9:80821275-80821297 ATATAGATATTTACGTGATTAGG + Intergenic
1056060142 9:82877070-82877092 ATATACATAATAAGGTAATGGGG - Intergenic
1059887781 9:118766080-118766102 ATATGGATCCATAGATAATGAGG - Intergenic
1060845568 9:126834307-126834329 CTATAGATACTTAGGTAATGTGG + Exonic
1061956583 9:133965699-133965721 CTATAGATATTTTGGTAGTGTGG - Intronic
1062313865 9:135955754-135955776 AGGTAGATCTTTAGGTCATCAGG - Intronic
1185997605 X:4969362-4969384 ATATAGAAATTTGAGTAATGTGG - Intergenic
1187780605 X:22818517-22818539 ATTTAACTCTTTAGTTAATGAGG + Intergenic
1193371441 X:80702236-80702258 AGACAGTTCTTCAGGTAATGAGG - Intronic
1196900728 X:120380295-120380317 ATAGAGGTCTTTAGGTATAGCGG - Exonic
1197460899 X:126739494-126739516 ATATATATCTTTATGTTTTGTGG + Intergenic
1197489252 X:127097216-127097238 ATAGAGGTGTTTAGGTCATGGGG - Intergenic
1198549057 X:137725521-137725543 ACATAGATATTTAGGTGATGGGG + Intergenic
1198984732 X:142436867-142436889 ATATATATCCTAAGGAAATGAGG + Intergenic
1199348631 X:146773262-146773284 TCATAGATCTTTTAGTAATGTGG + Intergenic
1201420977 Y:13798476-13798498 ATATAAGTCTTCAAGTAATGGGG - Intergenic