ID: 1010370429

View in Genome Browser
Species Human (GRCh38)
Location 6:75100711-75100733
Sequence TCTGCCCAATGGTGTCTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 148}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010370424_1010370429 -4 Left 1010370424 6:75100692-75100714 CCTCTGAATGGCCTACCTCTCTG 0: 1
1: 0
2: 0
3: 14
4: 185
Right 1010370429 6:75100711-75100733 TCTGCCCAATGGTGTCTTGGAGG 0: 1
1: 0
2: 2
3: 25
4: 148
1010370423_1010370429 -3 Left 1010370423 6:75100691-75100713 CCCTCTGAATGGCCTACCTCTCT 0: 1
1: 0
2: 2
3: 38
4: 223
Right 1010370429 6:75100711-75100733 TCTGCCCAATGGTGTCTTGGAGG 0: 1
1: 0
2: 2
3: 25
4: 148
1010370421_1010370429 30 Left 1010370421 6:75100658-75100680 CCATTTTGTATTATCTTAGGGCA 0: 1
1: 0
2: 0
3: 15
4: 179
Right 1010370429 6:75100711-75100733 TCTGCCCAATGGTGTCTTGGAGG 0: 1
1: 0
2: 2
3: 25
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010370429 Original CRISPR TCTGCCCAATGGTGTCTTGG AGG Intronic
900012639 1:130319-130341 TTTGCTTAATGGTGTCTTGTTGG - Intergenic
900042703 1:486306-486328 TTTGCTTAATGGTGTCTTGTTGG - Intergenic
900064141 1:721297-721319 TTTGCTTAATGGTGTCTTGTTGG - Intergenic
900689762 1:3973518-3973540 TATTCCCCATGGTGTCTAGGGGG + Intergenic
900910684 1:5594899-5594921 CTTGTCCAATGGTGTCATGGTGG - Intergenic
901159783 1:7166761-7166783 TGTTCCTAATGGTGTCTTGGTGG + Intronic
902966981 1:20012496-20012518 CCTGCCCCAGTGTGTCTTGGAGG - Intergenic
903832688 1:26184151-26184173 TCTGTCCAGGTGTGTCTTGGTGG + Intronic
904382101 1:30118591-30118613 TCTGCCCACTGGGCCCTTGGAGG + Intergenic
905017568 1:34788031-34788053 CCTGGCCAAGGGTGGCTTGGAGG + Intronic
905490040 1:38336249-38336271 CCTGCCAAAGGGTGTCATGGGGG + Intergenic
911484288 1:98486306-98486328 TCTGCCCAATTAAGTTTTGGAGG - Intergenic
911816126 1:102353712-102353734 TCTGCCCAATGATACATTGGAGG - Intergenic
915962430 1:160278505-160278527 TCTGCCCCATGGGGCCTTGCAGG + Exonic
917633073 1:176908944-176908966 ACTGGCCAATGGAGCCTTGGTGG - Intronic
922261076 1:223946809-223946831 TTTGCCTAATGGTGTCTTGTTGG - Intergenic
922735996 1:227978931-227978953 TTTGCCTAATGGTGTCTTGTTGG + Intergenic
924342245 1:243048988-243049010 TTTGCCTAATGGTGTCTTGTTGG - Intergenic
1065363975 10:24916991-24917013 TCAGCTCAATGGTGTATTCGAGG + Intronic
1066734236 10:38456564-38456586 TTTGCCTAATGGTGTCTTGTTGG + Intergenic
1068665010 10:59664477-59664499 GCTGCCCAATGGTGTCTATTGGG - Intronic
1073048391 10:100653354-100653376 TGTGCCCCATGCTGTCCTGGGGG + Intergenic
1073431923 10:103492752-103492774 GCTGCCAAATGGAGACTTGGGGG + Intergenic
1075640808 10:124063032-124063054 TTTGCCTCCTGGTGTCTTGGTGG - Intronic
1076968976 11:122523-122545 TTTGCTTAATGGTGTCTTGTTGG - Intergenic
1083404516 11:62447332-62447354 TCTGCCCAGTGGGATCTAGGGGG + Intronic
1083811123 11:65107573-65107595 TCTTCCGGATGGTGTCTAGGAGG - Exonic
1084816519 11:71650527-71650549 TCTGCACCCTGGTGTCCTGGGGG + Intergenic
1085322727 11:75584486-75584508 TCTGCCCCCGGGTGTCTCGGAGG + Intergenic
1086204882 11:84245933-84245955 TCTGGCCAATTGGGTGTTGGTGG + Intronic
1090092817 11:123714034-123714056 CCTGCCAAGTGGTGTCTTAGTGG + Intergenic
1091820441 12:3471780-3471802 CCAGCCCAGTTGTGTCTTGGTGG - Intronic
1092426474 12:8379507-8379529 TCTGCACCCTGGTGTCCTGGGGG - Intergenic
1110912009 13:80977124-80977146 TCTACCCCAATGTGTCTTGGTGG - Intergenic
1115901024 14:38148381-38148403 TCTGCAAAATGGTCTCTTGTGGG + Intergenic
1117068465 14:52034016-52034038 TCTACCCAATGGTGGGGTGGGGG - Intronic
1117565490 14:56990368-56990390 TCTGCCCAATGGTGGCAATGAGG + Intergenic
1118487155 14:66224902-66224924 TGTGCCCACTAGGGTCTTGGGGG - Intergenic
1120700834 14:87697227-87697249 TCTGCCCAATGGTGTGTGAGTGG - Intergenic
1120929350 14:89832903-89832925 TCTGCCTTATACTGTCTTGGTGG + Intronic
1122358442 14:101139192-101139214 TCTACCCAATATTTTCTTGGAGG - Intergenic
1124169688 15:27361327-27361349 TTTTCCAAATGGTATCTTGGAGG + Intronic
1124500663 15:30224616-30224638 TCTTCCCGATGGTGCCTTCGCGG - Intergenic
1124742910 15:32314051-32314073 TCTTCCCGATGGTGCCTTCGCGG + Intergenic
1125831190 15:42718223-42718245 TGTGCCCAGTGGGGTCTTGCTGG + Intronic
1126140509 15:45434079-45434101 TCTGGCCAATGGTAACTTGAAGG + Intronic
1128780843 15:70357636-70357658 TCTGCCCAGTGGTGTCCGAGGGG - Intergenic
1129461126 15:75700542-75700564 CCTGCCCACTGGTGACTTGGAGG + Intronic
1129723704 15:77891200-77891222 CCTGCCCACTGGGGACTTGGAGG - Intergenic
1131351585 15:91705737-91705759 TCTGCCCAAGGGTGGGTTAGGGG - Intergenic
1131498813 15:92939964-92939986 CCTGTCCAATGGTGACTTAGTGG + Intronic
1132235328 15:100215828-100215850 TCAGGCAAATGGTGTCTTGGAGG - Intronic
1132594161 16:740665-740687 TGTGCCCCATGGTGTCCGGGCGG - Intronic
1133554643 16:6893639-6893661 TCTGGCCAATGCTCTATTGGAGG - Intronic
1134069482 16:11251950-11251972 TCAGCTCAAGGGTGGCTTGGAGG + Intronic
1134098093 16:11432686-11432708 TCTCTCCAATGGTGTCATGTAGG - Intronic
1134642221 16:15838243-15838265 TCTGCGCCATGGTGCCTTGTTGG + Exonic
1138368183 16:56500761-56500783 TATGCCCAGTGGATTCTTGGGGG - Intronic
1140126979 16:72125712-72125734 TCTGCCCATGGGTGACTCGGGGG - Intronic
1146597187 17:34179735-34179757 TCTGCCAAATGCTGTCTTGATGG + Intergenic
1147046889 17:37759279-37759301 TCTGTCCAGTGGCGTCTTGGGGG - Intergenic
1152628443 17:81399079-81399101 GCTGCCCAAAGGTGTCTCGGAGG - Intronic
1153611125 18:6886285-6886307 TCTTCAAAATGGTGTCTTGGTGG - Intronic
1156927748 18:42603165-42603187 TCTGTCTCATGGTGTCATGGTGG + Intergenic
1157572398 18:48721634-48721656 TCTGCACAATGGTGTCCTTGGGG - Intronic
1160645781 19:192449-192471 TTTGCTTAATGGTGTCTTGTTGG - Intergenic
1160724798 19:613379-613401 TCTTCCCGATGGTGCCTTCGCGG - Exonic
1161056432 19:2192944-2192966 TCTTCCCACTGGTGTGGTGGCGG + Intronic
1163154322 19:15431962-15431984 TGTGCCAAATGGGGCCTTGGAGG + Intronic
1163846687 19:19642175-19642197 TCTGAAGAATGGTGTTTTGGGGG + Intronic
1166935261 19:46328694-46328716 TTTGACCAATGGTTTCTTTGAGG + Intronic
925734418 2:6948783-6948805 TCTGGACATTGGTGTTTTGGAGG + Intronic
927671413 2:25071738-25071760 TCTTCCAAATTGTGTCATGGAGG + Intronic
928531130 2:32192447-32192469 TGTTCCCAAAGGTGTCATGGGGG - Intronic
929573896 2:43040275-43040297 TCTCCCCACTGGTGGCGTGGTGG - Intergenic
930606304 2:53496885-53496907 TCTCCTCAGTGGTGTGTTGGTGG + Intergenic
932427185 2:71645525-71645547 TCTGCCCGCTAGGGTCTTGGGGG + Intronic
932564628 2:72898097-72898119 TAAGCCCAATGGTGTTTTGCAGG + Intergenic
936076997 2:109407998-109408020 TCTGCCCAAGGATGGCCTGGAGG - Intronic
939436165 2:142180815-142180837 TCTGCCCACTAGGGTCTCGGGGG - Intergenic
941186231 2:162324558-162324580 TCTGCCTGCTGGGGTCTTGGAGG + Intronic
941870290 2:170377384-170377406 TATGCCCACTGTTGTCTTAGGGG + Intronic
942513225 2:176724740-176724762 TCTGCCCACTGGCGTTTTGTCGG + Intergenic
943050431 2:182907313-182907335 AGTGCCCACTGGTGTCTTTGGGG - Intergenic
944306837 2:198188666-198188688 TGTGCCCACTAGGGTCTTGGGGG - Intronic
945054371 2:205855393-205855415 TCTGCCCAAGTGTGTCTAGCAGG + Intergenic
949083131 2:242121160-242121182 TTTGCCTAATGGTGTCTTGTTGG + Intergenic
1169037830 20:2468281-2468303 TCTGCCAAATATAGTCTTGGAGG - Intronic
1173447118 20:43129156-43129178 TCTGCCCAAGGGGGTGTAGGGGG + Intronic
1173551368 20:43935077-43935099 TCTGTGCACTGGTGCCTTGGGGG + Intronic
1174450079 20:50614412-50614434 TCTGCACATTGGTGCTTTGGAGG + Intronic
1176279725 20:64293767-64293789 TTTGCCTAATGGTGTCTTGTTGG + Intergenic
1179723543 21:43329444-43329466 TCTGCACACTGGTGTCCAGGCGG + Intergenic
1179957916 21:44751475-44751497 TCTGCAAAATGGCGTCTTGGGGG + Intergenic
1181421662 22:22803510-22803532 TCTGCCTAAGGGTGTCTTGAGGG - Intronic
1181429792 22:22872157-22872179 TCTGCCTAGGGGTGTCTTGGAGG - Intronic
1183040081 22:35171449-35171471 ACAGCCCATTGGTGTCTCGGTGG + Intergenic
950750207 3:15122540-15122562 TCTGGGCACTGGTTTCTTGGTGG - Intergenic
951425073 3:22535265-22535287 TCTGCTGAATGGTTTCTGGGAGG + Intergenic
951897296 3:27622295-27622317 TCTGCCTGATGGTGTCTGAGGGG - Intergenic
952406328 3:33008410-33008432 CCTGCCCAGTGGTATCTAGGAGG - Intronic
954633255 3:52058039-52058061 TCCGCCCAAGGTTGTCCTGGGGG + Intergenic
955202208 3:56861503-56861525 TGAGCCCAATGGAGGCTTGGGGG + Intronic
956946311 3:74227254-74227276 TCTGCACAATGCTGTTTTGTTGG - Intergenic
957071148 3:75568807-75568829 TCTGCACTCTGGTGTCCTGGGGG - Intergenic
961282959 3:125777911-125777933 TCTGCACCCTGGTGTCCTGGGGG + Intergenic
962062189 3:131941041-131941063 AATGCCTAATAGTGTCTTGGAGG - Intronic
965351125 3:167612746-167612768 TCTTCCCAATTCAGTCTTGGTGG - Intronic
968046965 3:195630003-195630025 TCTGCCCAAGGGTCTCTTGGGGG - Intergenic
968307688 3:197660041-197660063 TCTGCCCAAGGGTCTCTTGGGGG + Intergenic
968371900 3:198227077-198227099 TTTGCTTAATGGTGTCTTGTTGG + Intergenic
968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG + Exonic
969014758 4:4096511-4096533 TCTGCACCCTGGTGTCCTGGGGG - Intergenic
969739183 4:9011936-9011958 TCTGCACCCTGGTGTCCTGGGGG + Intergenic
973728263 4:53797591-53797613 TCTGGCCAGTGGTATCTGGGCGG + Intronic
979111656 4:116764724-116764746 TCTGTCCAATGCTGTCTAAGTGG - Intergenic
979260588 4:118639554-118639576 TTTGCCTAATGGTGTCTTGTTGG + Intergenic
979839268 4:125417562-125417584 TCTGCCCAATAGAGTTATGGAGG + Intronic
980476532 4:133324723-133324745 TCTGCCCAATGGTGTCCATAAGG + Intergenic
983196218 4:164809566-164809588 TCTGGCCAATGGGATATTGGTGG - Intergenic
985744653 5:1639141-1639163 TCTGTACAAGGGTCTCTTGGGGG + Intergenic
985797703 5:1975534-1975556 TCTGCCCAAGCCTGTGTTGGTGG + Intergenic
991051949 5:62282265-62282287 TCTGCCCATTTGTGTCTGCGTGG - Intergenic
992174848 5:74139807-74139829 GGTGCCCCATGGTGTCTTGGGGG - Intergenic
997842114 5:137251353-137251375 TCTTCCCATTGTTGTCTTGATGG + Intronic
997964599 5:138347221-138347243 CCTGCCCATTGCTCTCTTGGTGG - Exonic
1000231570 5:159320366-159320388 TCTGCCCATTGAGGTCATGGTGG - Exonic
1001750483 5:174126644-174126666 TCTGGCCAATGGAGTGTGGGAGG + Intronic
1002731140 5:181332623-181332645 TTTGCTTAATGGTGTCTTGTTGG + Intergenic
1002753393 6:141481-141503 TTTGCCTAATGGTGTCTTGTTGG - Intergenic
1005072350 6:21873740-21873762 TTGGCCCAATGGTGTTTTGGCGG + Intergenic
1005199099 6:23322984-23323006 TGTGCCCAAGGTTGTCTTAGTGG - Intergenic
1006831176 6:36969164-36969186 CCTGCCCAGGGGTGTCTTTGGGG + Intronic
1010180519 6:73081547-73081569 TCTCCCCAAGGGAGTCTTTGAGG - Intronic
1010370429 6:75100711-75100733 TCTGCCCAATGGTGTCTTGGAGG + Intronic
1016524958 6:144991160-144991182 TCTGCACAATGCTTTGTTGGAGG + Intergenic
1018996479 6:168714192-168714214 TCTGCCCAATTATGTGTTGTGGG - Intergenic
1019649208 7:2147557-2147579 TCTGTGAAATGGGGTCTTGGGGG - Intronic
1020101557 7:5397008-5397030 TCTGCCCACTCCTGTCTTTGGGG - Intronic
1021441043 7:20676866-20676888 TCTGCCAATTTCTGTCTTGGAGG - Intronic
1024076281 7:45819786-45819808 TTTGCCTAATGGTGTCTTGTTGG + Intergenic
1025128122 7:56361665-56361687 TTTGCCTAATGGTATCTTGTTGG - Intergenic
1028483247 7:91331060-91331082 ATTGCCCAATGCTGTCTTTGGGG - Intergenic
1029073430 7:97918140-97918162 TCTGCACCCTGGTGTCCTGGGGG - Intergenic
1029114297 7:98229436-98229458 TCAGCCCCATGGTGACATGGAGG + Intronic
1029607317 7:101606712-101606734 TCTGCCCTGCAGTGTCTTGGAGG + Intergenic
1036256481 8:7210589-7210611 TCTGCACCCTGGTGTCCTGGGGG - Intergenic
1036308531 8:7669174-7669196 TCTGCACCCTGGTGTCCTGGGGG - Intergenic
1036889961 8:12590098-12590120 TCTGCACCCTGGTGTCCTGGGGG - Intergenic
1036897574 8:12648259-12648281 TCTGCACCCTGGTGTCCTGGGGG - Intergenic
1037226640 8:16600423-16600445 TCTGCTCAATTATGTCTTGCTGG + Intergenic
1037512840 8:19601261-19601283 TCTGACATATGGTGTCTTAGAGG - Intronic
1037808311 8:22070429-22070451 CCTGCCCTATGGTGTCCTCGTGG + Intronic
1038494381 8:27991124-27991146 TCTGCGTATTGGTTTCTTGGGGG + Intronic
1038698248 8:29825533-29825555 TCTGCTCCATGATGTCTCGGTGG + Intergenic
1040824164 8:51601297-51601319 TCTGTCCAATGTTGTCGTTGGGG + Intronic
1045173548 8:99696647-99696669 TCTCCTCGATGGTGTCCTGGAGG - Intronic
1048367703 8:133752917-133752939 TCTGCTCAAATGTGTCTTGTTGG + Intergenic
1053582119 9:39415904-39415926 TTTGCCCCATGCTGTCTTGAAGG - Intergenic
1053846537 9:42243231-42243253 TTTGCCCCATGCTGTCTTGAAGG - Intergenic
1054103697 9:60974643-60974665 TTTGCCCCATGCTGTCTTGAAGG - Intergenic
1054582653 9:66932203-66932225 TTTGCCCCATGCTGTCTTGAAGG + Intergenic
1055396508 9:75880933-75880955 TCTGCTAAATGGAGTCTGGGTGG - Intergenic
1056011091 9:82331417-82331439 TTTGGCCAATGGAGTGTTGGAGG - Intergenic
1056664810 9:88572899-88572921 TCTGCACAATGGCCTCTTGTGGG - Intronic
1057429389 9:94980156-94980178 GCTGTCCAATGGTCTCTGGGAGG - Intronic
1061763193 9:132864570-132864592 TCTTCCCAATGCTGTCATTGAGG - Intronic
1061904596 9:133690303-133690325 TCTGCCCAAGGGCCTGTTGGAGG + Intronic
1062412829 9:136433501-136433523 TCTGCTCACTGGGGTCTCGGCGG - Intronic
1062755546 9:138285130-138285152 TTTGCTTAATGGTGTCTTGTTGG + Intergenic
1203579461 Un_KI270745v1:29302-29324 TTTGCTTAATGGTGTCTTGTTGG + Intergenic
1189376086 X:40467248-40467270 TCTGCCCTCTGATCTCTTGGTGG + Intergenic
1190652015 X:52576938-52576960 TTTGCCCTCTGGTCTCTTGGAGG + Intergenic
1200083931 X:153593551-153593573 TCTGCGCAGTAGTGTCTTAGTGG - Intronic
1202382064 Y:24281923-24281945 TTTGCCTAATGGTGTCTTGTGGG + Intergenic
1202488720 Y:25388202-25388224 TTTGCCTAATGGTGTCTTGTGGG - Intergenic