ID: 1010370544

View in Genome Browser
Species Human (GRCh38)
Location 6:75101988-75102010
Sequence GACCAACTCACTGTTCGGCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 42}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010370544 Original CRISPR GACCAACTCACTGTTCGGCC TGG Exonic
901371599 1:8803179-8803201 AAAGAAGTCACTGTTCGGCCAGG + Intronic
901838803 1:11940829-11940851 TCCCAGCTCACTGTTAGGCCAGG - Intronic
913379226 1:118190227-118190249 GACCAAGTCACTTCTAGGCCAGG + Intergenic
922339392 1:224643477-224643499 GACCCACTCACTGTCCCACCAGG - Intronic
1063355436 10:5394443-5394465 GTCCACCACACTGTTCTGCCTGG + Exonic
1069102086 10:64334794-64334816 GACCAACGCAGTGGTCGGCAGGG + Intergenic
1073372962 10:103007189-103007211 GACCTACTCCCTGTTCGTACAGG - Intronic
1075701839 10:124474925-124474947 GACAAACCCACTGTTGGGGCAGG - Intronic
1076840919 10:133044781-133044803 GAACAACTCACAATTGGGCCTGG + Intergenic
1082033766 11:47626906-47626928 GAATAACTCAGTTTTCGGCCAGG - Intronic
1091301307 11:134509871-134509893 TCCCAACTCACTGATGGGCCAGG + Intergenic
1138315182 16:56063832-56063854 CACAAACTCCCTGTTCGTCCAGG - Intergenic
1145938368 17:28727914-28727936 GAAAAACTCAGTATTCGGCCAGG - Intronic
1146654972 17:34629769-34629791 GTCCACCTCACTGTGCTGCCGGG - Intronic
1147881738 17:43658821-43658843 GACAAACTCACTGTTCAGCATGG - Intronic
1150282240 17:63935448-63935470 GACCAACGCACTGTTGGGGCCGG - Intergenic
1157298494 18:46462644-46462666 GACCACCACACTGCTGGGCCTGG + Exonic
1160131622 18:76230544-76230566 GACCAACTCACTGCTCTGGAAGG + Intergenic
1166084269 19:40464866-40464888 GACCAACTCCCAGCTGGGCCTGG - Intronic
1168595276 19:57670523-57670545 CATCAGCTCAGTGTTCGGCCCGG + Exonic
926446745 2:12952067-12952089 GACCATCACATTGTTCAGCCTGG + Intergenic
1168911557 20:1451995-1452017 GAGCAACACACTGTGAGGCCTGG + Intronic
1173224948 20:41156999-41157021 GAGCATCTCACTGTGCTGCCAGG + Intronic
1182621125 22:31619282-31619304 GACCAACTGAAGGTTCGGTCAGG + Exonic
953571089 3:44072564-44072586 GGCCAACTCGGTGTTTGGCCTGG + Intergenic
957149146 3:76462978-76463000 GACCTACACACTGTTCAGACTGG - Intronic
959813188 3:110643241-110643263 AACTGACTCACAGTTCGGCCTGG - Intergenic
960415783 3:117383332-117383354 GAACAACTGAGTGTTTGGCCAGG + Intergenic
962266610 3:133948650-133948672 GATGAACTCACTCTTCGTCCTGG - Exonic
971972111 4:33634080-33634102 AATCAACTCACAGTTCGGCATGG - Intergenic
972767713 4:42166996-42167018 GACTAACTCACTCCTCTGCCAGG + Intergenic
978680645 4:111377584-111377606 GAAAAAGTCACTGTTGGGCCGGG + Intergenic
981886224 4:149675956-149675978 AACCAACTCTCTGTGTGGCCTGG - Intergenic
987675197 5:21064510-21064532 GATCAACTCACAGTTCCACCTGG - Intergenic
999166955 5:149557637-149557659 AAGCAACTCCCTGTTAGGCCAGG - Intronic
1001118987 5:168963195-168963217 GTCTCACTCACTGTTTGGCCAGG + Intronic
1001527833 5:172441345-172441367 GACACACTGACTGCTCGGCCTGG + Intronic
1001543303 5:172554191-172554213 TACCAACTCACTGTGTGCCCTGG + Intergenic
1010370544 6:75101988-75102010 GACCAACTCACTGTTCGGCCTGG + Exonic
1014826481 6:126053482-126053504 GACCTAATCACTTTTGGGCCAGG + Intergenic
1019475149 7:1240985-1241007 GCCCAATTCACTGCTCAGCCGGG + Intergenic
1022960616 7:35422925-35422947 GACATACTCACTGTTCACCCTGG - Intergenic
1038679494 8:29653705-29653727 GACTAACTCCCTGTTAAGCCAGG - Intergenic
1045775539 8:105797973-105797995 GCCCAACTCTGTGTTCGGCTGGG - Intronic
1194977220 X:100408069-100408091 GCCCAACGAGCTGTTCGGCCTGG - Exonic