ID: 1010370679

View in Genome Browser
Species Human (GRCh38)
Location 6:75103476-75103498
Sequence CAGAACATGGGGAAGCAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 852
Summary {0: 1, 1: 0, 2: 2, 3: 60, 4: 789}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010370679 Original CRISPR CAGAACATGGGGAAGCAGAG GGG (reversed) Intronic
900394437 1:2447416-2447438 CAGAACCTGGGGGAGGGGAGGGG - Intronic
900527391 1:3135898-3135920 CAGAGCCTGGGGCTGCAGAGCGG + Intronic
900542797 1:3212502-3212524 CAGAACATGGGGACGGAGGCAGG - Intronic
900875063 1:5336516-5336538 GAGAAAATGAGGAAACAGAGAGG - Intergenic
901095916 1:6679482-6679504 CAGAAATTGGTGAAGCAGAGGGG - Intronic
901228368 1:7628169-7628191 CAGCACATGGAGAAGGAGAAGGG - Intronic
901305721 1:8231410-8231432 CAGCACTTTGGGAAGCTGAGGGG + Intergenic
901855090 1:12039433-12039455 CAGGGCTGGGGGAAGCAGAGGGG - Intergenic
903144384 1:21361338-21361360 CAGAACATGGGATATCAGACAGG + Intergenic
903145349 1:21368576-21368598 CAGACCGTGGGAAAGGAGAGGGG - Intergenic
903341236 1:22655812-22655834 CTTAAAATGGGGGAGCAGAGTGG - Intronic
904027630 1:27514354-27514376 CAGAACATGTGGAAGGAGCTAGG - Intergenic
904078831 1:27859160-27859182 GCGAGCAAGGGGAAGCAGAGAGG - Intergenic
904190737 1:28741540-28741562 CAGAACTTTGGGAGACAGAGGGG - Intronic
904415822 1:30360529-30360551 CAGGGCCTGGGGGAGCAGAGAGG - Intergenic
904667616 1:32135313-32135335 CAGAACTTTGGGAGGCTGAGGGG - Intronic
904714659 1:32458235-32458257 CAGAACCTGGAGATGCAGAGGGG + Intergenic
905022703 1:34828704-34828726 CAGAGGATGGGGCAGCAGAAGGG - Intronic
905360675 1:37417943-37417965 CAGCACATGGGAAGGCCGAGGGG + Intergenic
906216860 1:44046770-44046792 CAGCACATTGGGAGGCCGAGAGG + Intergenic
906432991 1:45770807-45770829 CAGATCTTGGGAAAGCAGATGGG + Intergenic
906463968 1:46059564-46059586 CAGCACTTTGGGAAGCTGAGCGG + Intronic
906492540 1:46279461-46279483 CAGACCCTGGGGAGGGAGAGGGG - Intronic
906618167 1:47249605-47249627 CAGAACTTTGGGAGGCAGAGTGG + Intergenic
906951497 1:50337716-50337738 CAGAACTTTGGGAGGCCGAGGGG - Intergenic
907172540 1:52482680-52482702 CAGAACTTTGGGAGGCCGAGCGG - Intronic
907172615 1:52483560-52483582 CAGCACTTTGGGAGGCAGAGTGG + Intronic
907246221 1:53110778-53110800 CAGAGCAGGGGCAAGCAGAGAGG - Intronic
907681546 1:56568871-56568893 CAGCACTTGGGGAGGCCGAGTGG - Intronic
907793946 1:57695649-57695671 CAGCACTTGGGGAGGCAGAGTGG + Intronic
908235470 1:62143696-62143718 CAGCACTTTGGGAGGCAGAGTGG - Intronic
908402617 1:63785772-63785794 CAGCACTTTGGGAAGCTGAGCGG - Intronic
908601024 1:65740135-65740157 CAGCACTTTGGGAGGCAGAGGGG - Intergenic
909862998 1:80632652-80632674 CAGGAGATGGGGAGCCAGAGGGG - Intergenic
909934303 1:81533128-81533150 CAGAACTTTGGGAGGCCGAGGGG + Intronic
909942483 1:81626520-81626542 CAGCACTTTGGGAAGCCGAGGGG - Intronic
910016011 1:82525003-82525025 CAGAACTTTGGGAGGCTGAGGGG - Intergenic
910193985 1:84621805-84621827 CAGCACTTTGGGAAGCCGAGGGG + Intergenic
910604768 1:89071732-89071754 CAGCCCATGGAGAAGCAGGGTGG + Intergenic
911007975 1:93247662-93247684 CAGCACTTTGGGAAGCTGAGGGG - Intronic
911051696 1:93676908-93676930 TAGATCTTGGGGAAGCAGAGAGG - Intronic
911192974 1:94965969-94965991 CAGCACTTTGGGAAGCCGAGGGG - Intergenic
911271587 1:95808175-95808197 CAGAAGATAGGGAGGCAGTGCGG - Intergenic
911290339 1:96049914-96049936 CAGAACAAGAGGAAACAAAGTGG + Intergenic
912358746 1:109076872-109076894 CAGCACTTTGGGAGGCAGAGCGG - Intergenic
912532052 1:110331925-110331947 CAGCACTTAGGGAGGCAGAGAGG - Intergenic
912557002 1:110523782-110523804 CAGAAGATGGGAAAGCATAGGGG - Intergenic
912824269 1:112891239-112891261 CAGTACTTTGGGAGGCAGAGGGG - Intergenic
912913641 1:113789288-113789310 CTGAACATGTGGAAGCAGACAGG + Intronic
913438524 1:118872449-118872471 CAGCACTTAGGGAGGCAGAGGGG - Intergenic
914420545 1:147524590-147524612 CAGCACTTTGGGAAGCCGAGGGG - Intergenic
914445922 1:147750704-147750726 CAGGACCTGGGGATTCAGAGAGG - Intergenic
914452162 1:147802301-147802323 CAGAATCTGGGGAAGCAAAAGGG - Intergenic
914816427 1:151066384-151066406 CAGAAGTTTGGGAGGCAGAGTGG - Intronic
915102254 1:153508736-153508758 CAGCACTTTGGGAGGCAGAGGGG + Intergenic
915207106 1:154278274-154278296 CAGCACTTTGGGAAGCTGAGCGG + Intergenic
915504277 1:156343312-156343334 CAGAATAATGGGAAGAAGAGCGG + Intronic
916238457 1:162614200-162614222 CAGCACTTTGGGAGGCAGAGGGG + Intergenic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
917443603 1:175088173-175088195 CCTAACAAGGGGAAGGAGAGAGG - Intronic
918038031 1:180894455-180894477 CAGAACATAAGGTAGAAGAGAGG + Intergenic
918148934 1:181781591-181781613 CAGAACATGGGGAGGAAGCCAGG + Intronic
918178536 1:182066340-182066362 CAGAGCATGGGGAAGAACATAGG - Intergenic
919432806 1:197517905-197517927 CAAAACATGGGGAGGCTGGGGGG - Intronic
919694851 1:200564011-200564033 CAGCACTTTGGGAAGCTGAGGGG + Intronic
920307951 1:205031054-205031076 CAGGAAAGGGGGAAGGAGAGAGG + Intergenic
920448955 1:206042562-206042584 CAGCACTTTGGGAAGCCGAGGGG - Intronic
920662202 1:207924823-207924845 CATGACATTGGGAAGAAGAGAGG + Intergenic
922037105 1:221859727-221859749 CAGCACTTCGGGAAGCTGAGGGG + Intergenic
922306056 1:224345604-224345626 CAGCACTTTGGGAAGCCGAGGGG - Intergenic
922453085 1:225752282-225752304 CAGAACAGGGGGAAGAAAATGGG - Intergenic
922911628 1:229222765-229222787 CAGCACTTTGGGAAGCCGAGGGG - Intergenic
923472204 1:234301990-234302012 GAGAACATGTGGACACAGAGAGG + Intronic
923679472 1:236107899-236107921 CAGCACTTTGGGAAGCCGAGGGG + Intergenic
923926260 1:238630406-238630428 CAGAACTTTGGGAAGCCAAGGGG - Intergenic
924437254 1:244052970-244052992 CAGAATATTAGGAACCAGAGGGG - Intronic
1063050648 10:2443577-2443599 CAGAACTTTGGGAGGCTGAGGGG - Intergenic
1063925075 10:10969594-10969616 CAGAGAATGGGGAAGGGGAGAGG - Intergenic
1063971892 10:11386988-11387010 CAGCACTTTGGGAAGCTGAGGGG - Intergenic
1064106293 10:12503480-12503502 CAGAAGAAGGGAGAGCAGAGAGG + Intronic
1064204612 10:13312550-13312572 CAGCACTTGGGGAGGCAGAGGGG + Intergenic
1064257952 10:13760683-13760705 CAAAGCATGGGGAAACAGACAGG + Intronic
1064430648 10:15267354-15267376 CAGCACTTTGGGAAGCTGAGGGG + Intronic
1064482100 10:15749955-15749977 CAAAACAAGGGGGAGCACAGTGG - Intergenic
1064767385 10:18688436-18688458 CAGAACTTTGGGAGGCTGAGGGG + Intergenic
1064837329 10:19548245-19548267 CAGAACTTTGGGCGGCAGAGGGG - Intronic
1064947301 10:20805216-20805238 CAGGGAAGGGGGAAGCAGAGAGG + Intronic
1064984265 10:21194218-21194240 CAGTACTTTGGGAAGCTGAGGGG - Intergenic
1065781833 10:29176077-29176099 CAGCACTTTGGGAGGCAGAGGGG - Intergenic
1065794070 10:29290395-29290417 AAGCACCTGGGGGAGCAGAGGGG - Intronic
1066383283 10:34919701-34919723 CAGCACTTGGGGAGGCTGAGGGG + Intergenic
1066675357 10:37881759-37881781 CAGCACATTGGGAGGCTGAGTGG - Intergenic
1067200973 10:44171869-44171891 CAGGAAATGGGTAAGCAGGGAGG + Intergenic
1067460298 10:46453235-46453257 AAGAATATGGGGAAGGAGACAGG - Intergenic
1067565063 10:47330537-47330559 AAGACAATGGGGATGCAGAGAGG + Intergenic
1067626892 10:47931368-47931390 AAGAATATGGGGAAGGAGACAGG + Intergenic
1067923808 10:50487108-50487130 GAGAACATGTGGATGCATAGTGG + Intronic
1068180767 10:53515685-53515707 CAGAACTTTGGGAGGCCGAGGGG + Intergenic
1068407949 10:56617071-56617093 CAGCACTTTGGGAGGCAGAGAGG - Intergenic
1068969203 10:62945448-62945470 CAGACCAGGGGGAAGCAGTAGGG - Intergenic
1069439888 10:68418632-68418654 GAGAACATGTGGACACAGAGAGG - Intronic
1069472649 10:68706570-68706592 CAGCACATTGGGAGGCAGGGGGG + Intergenic
1069532340 10:69228615-69228637 CAGAACTTTGGGAGGCCGAGGGG + Intronic
1069661839 10:70128070-70128092 TAGATCATGGCCAAGCAGAGGGG - Intronic
1069882486 10:71602484-71602506 GAGATCATGTGGAAGCAGTGTGG - Intronic
1069901798 10:71710707-71710729 CAGTACATGAAGAAGCAGGGAGG + Intronic
1069931359 10:71884054-71884076 CAGCACTTTGGGAGGCAGAGGGG - Intergenic
1071547383 10:86538857-86538879 CATAAGATGGGGAGGGAGAGAGG - Intergenic
1071753030 10:88502973-88502995 CAGTACCTGGGGAATCACAGTGG - Intronic
1072454580 10:95564681-95564703 CAGCACTTGGGGAGGCTGAGGGG - Intergenic
1072537232 10:96372936-96372958 CAGAACTTTGGGAGGCTGAGTGG - Intronic
1072583075 10:96757081-96757103 CAAGTCATGGGGATGCAGAGAGG - Intergenic
1072650515 10:97291540-97291562 CAGCACTTTGGGAAGCCGAGGGG - Intronic
1072682728 10:97518213-97518235 CAGAGCTGGGGGAAGCAGATGGG + Intronic
1072799668 10:98384367-98384389 CAGCACTTTGGGAAGCTGAGTGG + Intronic
1072822953 10:98576525-98576547 GAGGACAAGGAGAAGCAGAGAGG + Intronic
1073018910 10:100424598-100424620 CAGAACTTTGGGAGGCCGAGGGG + Intergenic
1073055094 10:100694840-100694862 CAGCACTTTGGGAAGCTGAGGGG - Intergenic
1073155782 10:101345404-101345426 CAGAACTTTGGAAGGCAGAGAGG - Intergenic
1073831195 10:107385255-107385277 CAGAAGATGGAGGATCAGAGAGG - Intergenic
1074466131 10:113682485-113682507 CTGAAAAGGGGGAAGCAGAGAGG - Intronic
1074877598 10:117626184-117626206 CAGAACAGGGGTGAGGAGAGGGG - Intergenic
1075035511 10:119063832-119063854 CAGCACTTAGGGAAGCCGAGGGG + Intronic
1075388948 10:122078418-122078440 CAGATGATGGGGATGCAGATGGG - Intronic
1075416538 10:122268497-122268519 AAGAACATGGGGGCGGAGAGGGG - Intergenic
1075668216 10:124245497-124245519 CAGCACTTGGGGAGGCTGAGGGG + Intergenic
1076471415 10:130721266-130721288 CAGAACTTTGGGAGGCCGAGGGG - Intergenic
1076790335 10:132773832-132773854 CAGAAGATGGGGCTGCAGTGAGG - Intronic
1077198510 11:1293466-1293488 GACAACAAGGGGAAGCAGCGAGG + Intronic
1077348889 11:2080921-2080943 CAGAACTTTGGGAGGCTGAGGGG - Intergenic
1078021029 11:7655987-7656009 CATATCATGGGGAAGCAGTTTGG + Intronic
1078095674 11:8295228-8295250 GAGAGCATGGGGAAGCAGCCGGG + Intergenic
1078119182 11:8489008-8489030 CAGCACTTTGGGAAGCTGAGGGG + Intronic
1079013304 11:16847338-16847360 CAGGACTTTGGGAGGCAGAGGGG - Intronic
1079109909 11:17599564-17599586 CAGCACTTGGGGAAGAAGGGAGG + Intronic
1079155136 11:17939195-17939217 CAGAACAAGGAGAACAAGAGGGG + Intronic
1079241813 11:18727144-18727166 CAGCACATTGGGAGGCCGAGGGG - Intergenic
1079384642 11:19968012-19968034 CAGAACCTGGGGCAGCAGGGAGG - Intronic
1080037786 11:27727398-27727420 GAGAAAATGAGGAGGCAGAGGGG + Intergenic
1080642913 11:34168151-34168173 CAGGGCATGGGGAAGGTGAGTGG + Intronic
1080703567 11:34666995-34667017 CAGCACTTTGGGAAGCTGAGGGG - Intergenic
1081818299 11:45966113-45966135 GAGAACATTGGGAAGAAAAGGGG - Intronic
1083225585 11:61282498-61282520 AAGAAAATGGGTGAGCAGAGAGG + Intronic
1083653630 11:64218828-64218850 TGGAACATGGGGAAGCAGTCAGG - Intronic
1083687998 11:64388836-64388858 CAGAAGCAGGGGATGCAGAGAGG + Intergenic
1084113000 11:67025463-67025485 CATAACATGGGGGACCAGAGTGG - Intronic
1084128155 11:67114624-67114646 CAGCACTTTGGGAGGCAGAGGGG + Intergenic
1084162505 11:67357367-67357389 CAGCAGAAGGGGAAGCTGAGAGG + Intronic
1084311399 11:68318291-68318313 CAGCACCTTGGGAAGCCGAGCGG - Intronic
1084428235 11:69097223-69097245 CAGGACACGGGAAAGGAGAGAGG - Intergenic
1084509386 11:69593694-69593716 CAGCCCATGGGGGAGCAGATTGG + Intergenic
1084985841 11:72870650-72870672 CAGCACTTTGGGAAGCCGAGGGG + Intronic
1085261374 11:75207137-75207159 CTGACCAAGGGGAAGCTGAGTGG - Intergenic
1085335574 11:75691467-75691489 CAGAACTTTGGGAGGCAGAGCGG - Intergenic
1085625275 11:78067071-78067093 CAGCACTTTGGGAAGCCGAGCGG - Intronic
1086041001 11:82478879-82478901 GAGAACATGTGGAAACATAGAGG + Intergenic
1086172301 11:83850399-83850421 CAGCACTTTGGGAGGCAGAGAGG - Intronic
1086202777 11:84223802-84223824 CAGAACTTTGGGAGGCTGAGGGG - Intronic
1086205033 11:84248039-84248061 TAGAACATGAGGAAGAAAAGAGG + Intronic
1088668971 11:112122572-112122594 CAGCACTTTGGGAAGCCGAGGGG + Intronic
1089363001 11:117903540-117903562 CCGAATATGGGGACGCTGAGGGG + Intronic
1089965269 11:122650482-122650504 CAGAACTTTGGGAGGCTGAGGGG - Intergenic
1090026350 11:123170687-123170709 CAGCACATTGGGAGGCCGAGCGG - Intronic
1091602692 12:1927695-1927717 GAGGACAAGGGGAAGCAGAGGGG + Intergenic
1091953519 12:4615709-4615731 CAGAAGAGGGGAAAGCAGTGGGG + Exonic
1092460759 12:8683994-8684016 CAGCACTTTGGGAAGCCGAGGGG - Intronic
1092464762 12:8720786-8720808 CAGCACTTTGGGAAGCCGAGGGG - Intronic
1092611027 12:10173529-10173551 CAGCACTTTGGGAAGCTGAGGGG + Intronic
1093102553 12:15045481-15045503 CAGAACATGGGGAGGAATAAAGG + Intergenic
1094408154 12:30140936-30140958 CTTAACTTGGGGAAGCAGAAAGG - Intergenic
1094514503 12:31119282-31119304 AAGAGCAGGGGGAAGGAGAGGGG - Intergenic
1095394709 12:41748572-41748594 CAGAAGATGGTGAATCAAAGTGG + Intergenic
1095431792 12:42142590-42142612 CAGAATTTGGGGAGGCTGAGTGG - Intronic
1095520317 12:43055999-43056021 CAGAACATGGGAAAACTGAGAGG - Intergenic
1095581177 12:43801384-43801406 TAGAACATGGGGAATTAAAGAGG + Intronic
1095610937 12:44127426-44127448 CAGAACTTTGGGAGGCCGAGGGG + Intronic
1095821187 12:46480267-46480289 CAGAAGGTGGGTAACCAGAGAGG + Intergenic
1095822068 12:46489219-46489241 CAGATTGTGGGGAACCAGAGGGG - Intergenic
1095982535 12:47981429-47981451 AAGAAGGTGGGGAGGCAGAGTGG + Intronic
1096095519 12:48932958-48932980 CTGAACATGGTGTAGAAGAGAGG - Intronic
1096333648 12:50736426-50736448 CAGAATATGGGTAACCAGAGAGG + Intronic
1096584477 12:52610919-52610941 CAGGACATGGGGCAGGACAGAGG - Intronic
1096970838 12:55665038-55665060 GAGAAGATGGGGAAGCACTGTGG - Intergenic
1097175100 12:57138006-57138028 CAGAAGGCAGGGAAGCAGAGAGG + Intronic
1097256551 12:57680367-57680389 CAGAACATTGGGAGGCCAAGAGG - Intergenic
1097928913 12:65162797-65162819 CAGTACATGGGACAGCAGGGTGG + Intergenic
1098160873 12:67648049-67648071 TAGGACAAGGGGAGGCAGAGAGG - Intergenic
1098583172 12:72125857-72125879 CAGAACATGGGGAACCCAGGAGG + Intronic
1099468291 12:83014585-83014607 CAGAACTTTGGGAGGCTGAGAGG - Intronic
1099973869 12:89525952-89525974 GAGAGGATGGGGAAGGAGAGGGG + Exonic
1099990238 12:89713745-89713767 CAGAGCAGGAGGAAGGAGAGAGG + Intergenic
1100306664 12:93355985-93356007 CAGCACATTGGGAGGCCGAGAGG - Intergenic
1101019790 12:100542095-100542117 CAGAACTTTGGGAGGCAGAGGGG + Intronic
1101067621 12:101039254-101039276 CAGCACATTGGGAGGCCGAGGGG + Intronic
1101247286 12:102896112-102896134 CAGAGCAGGGGGAAGCAAATGGG + Intronic
1101388594 12:104279540-104279562 AAGAAGATGAAGAAGCAGAGAGG + Intronic
1101644014 12:106611757-106611779 CAGAACTTTGGGAGGCTGAGGGG - Intronic
1101698675 12:107151373-107151395 CAGAACATCTTGAAGCAGGGAGG + Intergenic
1101839050 12:108314837-108314859 CAGCACTTTGGGAAGCAAAGTGG - Intronic
1101933978 12:109040888-109040910 CAGAACATGGGGGATCATTGGGG + Intronic
1102329009 12:112013500-112013522 CAGGAGAAGGGGAAGCAGCGGGG - Exonic
1102401964 12:112637728-112637750 CAAGACATGGTGGAGCAGAGAGG - Intronic
1103244287 12:119442361-119442383 CAGCACTTTGGGAGGCAGAGAGG + Intronic
1103368457 12:120400403-120400425 CAGCACTTTGGGAAGCTGAGGGG - Intergenic
1103610562 12:122121676-122121698 AAGAACAGGGGCAGGCAGAGAGG - Intronic
1104477894 12:129085216-129085238 CAGTAGAAGGGGAAGAAGAGGGG - Intronic
1105532824 13:21235530-21235552 CAGCACTTTGGGAGGCAGAGGGG + Intergenic
1105550301 13:21388585-21388607 CATAAAATGGGTAAGGAGAGTGG + Intronic
1105711904 13:23018623-23018645 CAGAACAAGGGGAGCCACAGTGG - Intergenic
1106893575 13:34273174-34273196 AAGAACATTGGGAAGTAGAGTGG + Intergenic
1108197675 13:48011088-48011110 CAGAACTTTGGGAGACAGAGGGG + Intergenic
1108894933 13:55314132-55314154 GAGAATATGGGGAAAAAGAGAGG - Intergenic
1108985702 13:56584584-56584606 CAGAACTTTGGGAGGCCGAGGGG - Intergenic
1110966115 13:81699208-81699230 AAGAACTTGGGGAGGCTGAGTGG + Intergenic
1111197787 13:84896148-84896170 CAGAACTTTGGGAGGCCGAGGGG - Intergenic
1112308340 13:98295553-98295575 AAGAACATGGGGGAGGAGAGGGG - Intronic
1112566870 13:100559433-100559455 CAGCACATTGGGAGGCCGAGGGG - Intronic
1113909886 13:113836749-113836771 AAGAAGATGGGGAGGAAGAGGGG + Intronic
1114263925 14:21060061-21060083 GATAGCATGGGGAAGAAGAGGGG - Intronic
1114297657 14:21344390-21344412 CAGAACAAGAGGATGGAGAGAGG - Intronic
1114601219 14:23956849-23956871 CAGCACATTGGGAGGCCGAGGGG - Intronic
1115544759 14:34455681-34455703 CAGCACTTTGGGAAGCTGAGGGG + Intronic
1115570179 14:34659092-34659114 CAGCACTTTGGGAAGCTGAGGGG + Intergenic
1116299829 14:43164452-43164474 AAAAACATGAGGAAGCAAAGGGG - Intergenic
1116463142 14:45201152-45201174 CAGCACTTGGGGAGGCCGAGGGG + Intergenic
1116653648 14:47625892-47625914 AAGAACATGGGGCAAAAGAGAGG - Intronic
1116797393 14:49406638-49406660 CAGCACTTTGGGAAGCAGACGGG + Intergenic
1116905967 14:50403873-50403895 GACAAAATGGGGAAGAAGAGAGG + Intronic
1117165595 14:53029523-53029545 CAGCACGTGGGGAGGCACAGTGG - Intergenic
1117582449 14:57166121-57166143 CAGAACTTTGGGAGGCTGAGGGG + Intergenic
1117721196 14:58630450-58630472 CAGAACAATGAAAAGCAGAGGGG + Intergenic
1117785510 14:59280494-59280516 GAGAAGATGGGGAAGCTGGGAGG - Intronic
1117915684 14:60675717-60675739 CAGCACTTTGGGAAGCTGAGTGG - Intergenic
1118110655 14:62715013-62715035 CAGAACATAATGAAGCACAGAGG - Intronic
1118315664 14:64724507-64724529 CAGGTCATGGGTAAGCAGAAAGG - Intronic
1118368433 14:65115332-65115354 CAGCACTTTGGGAGGCAGAGGGG + Intergenic
1118615627 14:67572786-67572808 GAGATGATGGGGCAGCAGAGAGG - Intronic
1119041202 14:71276299-71276321 GAGAACATGGTGATCCAGAGGGG + Intergenic
1119437816 14:74609645-74609667 CAGCATGTGGGGAAGCAGAGGGG - Intronic
1119717778 14:76870923-76870945 CACTACATGGGGCTGCAGAGGGG - Intergenic
1120059695 14:79967839-79967861 CGGCACTTTGGGAAGCAGAGGGG - Intergenic
1120393565 14:83939262-83939284 CAGAACATGGAGTGGCAGAGAGG + Intergenic
1120655961 14:87190141-87190163 CAGCACTTTGGGAAGCTGAGTGG - Intergenic
1120985783 14:90333206-90333228 CAGCACTTTGGGAGGCAGAGGGG - Intergenic
1121032973 14:90675083-90675105 CAGAACAATGGGAAGCCCAGGGG + Intronic
1121170818 14:91852822-91852844 CAGCACTTTGGGAGGCAGAGGGG + Intronic
1121544728 14:94755082-94755104 CAGCACTTTGGGAGGCAGAGGGG - Intergenic
1121952348 14:98182760-98182782 CAGAACAGGAGGAGGTAGAGAGG - Intergenic
1122038113 14:98962919-98962941 CAGCACTTTGGGAAGCGGAGGGG + Intergenic
1122446632 14:101774377-101774399 CAGAACATTGGTAAACTGAGTGG - Intronic
1123018933 14:105388583-105388605 CAGAACATGGGCTCGCACAGTGG - Intronic
1124134332 15:27020663-27020685 CAGCACTTTGGGAGGCAGAGGGG - Intronic
1124437839 15:29665675-29665697 CAGCACAGGGGAAAGCAGGGAGG + Intergenic
1125283256 15:38066092-38066114 GAGAAAAAGGGGAAGGAGAGAGG + Intergenic
1125385283 15:39130446-39130468 CAGCACATGGGCAACCAGAAGGG + Intergenic
1125661452 15:41398120-41398142 CAGCACTTTGGGAAGCCGAGGGG - Intronic
1125758067 15:42079086-42079108 CAGAAAATGGAGACACAGAGAGG + Intronic
1125936342 15:43639511-43639533 CAGCACTTTGGGAAGCCGAGGGG - Intronic
1126608697 15:50506709-50506731 CAGCACTTGGGGAGGCCGAGGGG + Exonic
1127366452 15:58295041-58295063 CAGAGCATGGGGCATCAGAGAGG + Intronic
1128241363 15:66103394-66103416 CAGAAAATGGAGACACAGAGAGG - Intronic
1128763155 15:70232703-70232725 CAACACATAGGAAAGCAGAGGGG + Intergenic
1129231636 15:74200294-74200316 AAGTGCATGAGGAAGCAGAGAGG + Intronic
1130065521 15:80600489-80600511 CAGCACTTTGGGAAGCTGAGAGG + Intergenic
1130634581 15:85605423-85605445 GAGAACATGTGGATGCAGGGAGG + Intronic
1130686774 15:86044608-86044630 GAGAAAATGGAGAAACAGAGAGG + Intergenic
1130857775 15:87856509-87856531 CAGAACATGGGGGAAAAGAGAGG + Intergenic
1130894147 15:88157636-88157658 CAGAACATGGGGGAACAGTGGGG + Intronic
1130993850 15:88893167-88893189 CAGCATTTGGGGAAGCTGAGGGG + Intronic
1131013520 15:89039006-89039028 CAGCACTTTGGGAGGCAGAGGGG - Intergenic
1131181035 15:90240257-90240279 CAGCACTTTGGGAAGCCGAGAGG + Intronic
1131472320 15:92708069-92708091 CAGGAACTGGGAAAGCAGAGGGG - Intronic
1131510081 15:93044942-93044964 CCACACATGGGGAAGCCGAGAGG + Exonic
1133693448 16:8237848-8237870 CAGCACTTTGGGAGGCAGAGGGG + Intergenic
1133795708 16:9044537-9044559 CAGCACTTTGGGAAGCCGAGGGG + Intergenic
1134326976 16:13216298-13216320 CAGAAAATAGGGGATCAGAGAGG - Intronic
1134828198 16:17301601-17301623 CAGAACAGCGTGAAGCAGATGGG + Intronic
1135238487 16:20781289-20781311 CAGAACCTGTGGATACAGAGGGG - Intronic
1135588391 16:23688682-23688704 CAGAAGATGGGGATGCAGGCAGG - Exonic
1135998001 16:27267989-27268011 CAGCACTTTGGGAAGCTGAGGGG - Intronic
1136088537 16:27902548-27902570 CAGAGCAAGGGGAGGGAGAGGGG + Intronic
1136188773 16:28603370-28603392 CAGCACTTTGGGAAGCTGAGAGG - Intergenic
1136822562 16:33331606-33331628 CAGCACTTTGGGAGGCAGAGAGG + Intergenic
1136829125 16:33388145-33388167 CAGCACTTTGGGAGGCAGAGAGG + Intergenic
1136834191 16:33486927-33486949 CAGCACTTTGGGAGGCAGAGAGG + Intergenic
1136956002 16:34787329-34787351 AACAAAATGGGGAAGAAGAGTGG - Intergenic
1137416032 16:48280758-48280780 CAGGACTTGGGCAAGCAGGGAGG - Intronic
1137440404 16:48493954-48493976 CAGCACTTTGGGAAGCTGAGGGG + Intergenic
1137583586 16:49650331-49650353 CAGGACATGGGCACTCAGAGAGG - Intronic
1137590003 16:49687639-49687661 CAGAAAATGAGGAACCAGGGGGG + Intronic
1137865716 16:51893865-51893887 AAGAACAGTGGGAAGGAGAGTGG + Intergenic
1137909076 16:52357732-52357754 CAGAACAAGCGGAAGCAAAATGG + Intergenic
1138248423 16:55484170-55484192 CAGAAGATGGGGCAGAAGAGGGG + Intronic
1138492933 16:57387142-57387164 CAGAACTTTGGGAGGCCGAGGGG - Intergenic
1138764516 16:59585717-59585739 CAGAACTTTGGGAGGCAGAGGGG + Intergenic
1139001776 16:62519577-62519599 AGGCACATGGGGAAGCAGTGGGG + Intergenic
1139444199 16:66986916-66986938 GAGACCATGGGGAAGATGAGTGG + Intergenic
1139497572 16:67331737-67331759 CAGCACTTTGGGAAGCCGAGGGG + Intronic
1139581829 16:67878394-67878416 CAGAACAGGAGGCAGGAGAGGGG - Exonic
1139634462 16:68249544-68249566 GAGGACCTGGGGAAGGAGAGAGG - Intronic
1139738659 16:69015726-69015748 CAGCACTTTGGGAAGCAGAGGGG - Intronic
1139958143 16:70703046-70703068 CAGGCACTGGGGAAGCAGAGTGG - Intronic
1140289985 16:73644409-73644431 CAGCACTTTGGGAGGCAGAGGGG + Intergenic
1140532733 16:75680857-75680879 CAGCACTTTGGGAGGCAGAGCGG + Intronic
1140584102 16:76268173-76268195 CAGAAGATAGGGAAGCAGTGGGG + Intergenic
1140699933 16:77572454-77572476 CAGCACTTGGGGAGGCTGAGGGG - Intergenic
1140900231 16:79360241-79360263 CAGAACATGAGGCAGGACAGAGG - Intergenic
1141161400 16:81631246-81631268 CAGGAGCTGAGGAAGCAGAGAGG + Intronic
1141724294 16:85776331-85776353 CAGAACTTTGGGAGGCCGAGGGG - Intronic
1141930369 16:87198244-87198266 CAGAACACAAGGCAGCAGAGAGG - Intronic
1142123579 16:88399229-88399251 CATCACATGAGGGAGCAGAGGGG - Intergenic
1203010725 16_KI270728v1_random:237593-237615 CAGCACTTTGGGAGGCAGAGAGG - Intergenic
1142632216 17:1232440-1232462 CAGCACTTGGGGAGGCAGAGAGG - Intergenic
1142661321 17:1431471-1431493 CAGCACTTTGGGAGGCAGAGGGG + Intronic
1143008319 17:3851580-3851602 CAGCACTTTGGGAGGCAGAGGGG - Intergenic
1143122858 17:4619990-4620012 CAGCACTTTGGGAAGCTGAGAGG + Intergenic
1143410599 17:6706244-6706266 CAGCTCATGGGGAAGCAGAAAGG - Intronic
1143470590 17:7172918-7172940 CAGCACTTTGGGAAGCCGAGGGG + Intergenic
1143725889 17:8845696-8845718 CAGCACTTTGGGAGGCAGAGGGG + Intronic
1144011682 17:11154588-11154610 CAGCACTTTGGGAGGCAGAGTGG - Intergenic
1144561150 17:16321184-16321206 CAGCACTTTGGGAAGCAGAGGGG - Intronic
1144580189 17:16454441-16454463 CAGCACTTTGGGAGGCAGAGGGG + Intronic
1144707797 17:17380877-17380899 CAGGACAGGGGGAGGCAGTGGGG + Intergenic
1144877714 17:18411095-18411117 CAGAAGGTGGGGAAGAAGACTGG - Intergenic
1145020927 17:19430092-19430114 CAAAACAAGGAGAAGCAGGGAGG + Intergenic
1145154515 17:20533308-20533330 CAGAAGGTGGGGAAGAAGACTGG + Intergenic
1145193971 17:20870295-20870317 CAGCACTTTGGGAAGCTGAGGGG - Intronic
1145214306 17:21041129-21041151 CAGCACGTGGGGAGGCCGAGGGG - Intronic
1145255826 17:21321850-21321872 GAGAACGTGGAGAATCAGAGAGG - Intergenic
1145320792 17:21766096-21766118 GAGAACGTGGAGAAGCAGAGAGG + Intergenic
1145746333 17:27322989-27323011 CAGCACTTTGGGAGGCAGAGTGG + Intergenic
1145797143 17:27662275-27662297 CAGCACCTGGGGGTGCAGAGTGG + Intergenic
1145811539 17:27767216-27767238 CAGCACCTGGGGGTGCAGAGTGG + Intronic
1146841920 17:36162212-36162234 CAGCACCCGGGGATGCAGAGTGG - Intergenic
1146854231 17:36250172-36250194 CAGCACCCGGGGATGCAGAGTGG - Intronic
1146870134 17:36374064-36374086 CAGCACCCGGGGATGCAGAGTGG - Intronic
1146877491 17:36425145-36425167 CAGCACCCGGGGATGCAGAGTGG - Intronic
1147012224 17:37459529-37459551 CAGCACTTTGGGAGGCAGAGGGG - Intronic
1147073015 17:37974688-37974710 CAGCACCCGGGGATGCAGAGTGG - Intergenic
1147084537 17:38054226-38054248 CAGCACCCGGGGATGCAGAGTGG - Intronic
1147100484 17:38178192-38178214 CAGCACCCGGGGATGCAGAGTGG - Intergenic
1147206751 17:38842776-38842798 CAGCACTTTGGGAAGCTGAGAGG - Intergenic
1147283457 17:39381846-39381868 CAGCACTTCGGGAAGCCGAGGGG + Intronic
1147365267 17:39954877-39954899 CAGCACTTTGGGAAGCTGAGGGG - Intergenic
1147750064 17:42725796-42725818 TAGTACATGGAGAAGCAAAGTGG + Intronic
1148005134 17:44421610-44421632 CAGCACTTTGGGAAGCTGAGGGG - Intronic
1148188677 17:45663522-45663544 CAGCACTTTGGGAAGCTGAGGGG + Intergenic
1148273514 17:46282668-46282690 CAGTACTTTGGGAAGCCGAGTGG - Intronic
1148491700 17:48027601-48027623 GGAAACATGGGGAATCAGAGGGG + Intronic
1148666777 17:49380874-49380896 CAGAACTTTGGGAGGCTGAGGGG - Intronic
1148795312 17:50194178-50194200 CAGACCCTAGGGAGGCAGAGAGG + Exonic
1149012271 17:51869659-51869681 CAGAACTTTGGGAGGCTGAGGGG + Intronic
1149267161 17:54939396-54939418 CAGGAGATGGGGAAGAACAGGGG + Intronic
1149790225 17:59470343-59470365 CAGCACTTTGGGAAGCTGAGGGG + Intergenic
1149881179 17:60292635-60292657 TAGAACATGGTGTAGCAGTGAGG - Intronic
1150083425 17:62261238-62261260 CAGCACCCGGGGATGCAGAGTGG - Intergenic
1150409548 17:64931909-64931931 CAGTACTTTGGGAAGCCGAGTGG + Intergenic
1151607010 17:75144066-75144088 CTGAACATGTGGAAGCTGACAGG + Intronic
1152698731 17:81808765-81808787 CAGAACTTTGGGAGGCCGAGGGG - Intronic
1152793517 17:82294651-82294673 TAGAACAGGCGGAAGCATAGTGG - Intergenic
1153295025 18:3536828-3536850 GAGAACATGGGGAAGGTGGGAGG + Intronic
1153304988 18:3623155-3623177 GAGGACATGGGGACACAGAGAGG - Intronic
1153654028 18:7266180-7266202 CAGCACTTTGGGAGGCAGAGGGG + Intergenic
1155344390 18:24844074-24844096 CAGCACTTTGGGAAGCCGAGGGG - Intergenic
1155374477 18:25140640-25140662 CAACACATGGGGAGACAGAGGGG + Intronic
1155455090 18:26003588-26003610 GAGAACATTGTGAAGCACAGAGG + Intergenic
1156325923 18:36075185-36075207 CAGCACTTTGGGAAGCTGAGTGG - Intergenic
1156550408 18:38010145-38010167 GAGAACATGGGCATGCAGAATGG + Intergenic
1156771586 18:40733813-40733835 CAGCACTTTGGGAAGCTGAGGGG - Intergenic
1160387615 18:78505981-78506003 CAGCACTTGGGGAAACAGAGAGG - Intergenic
1160397751 18:78584402-78584424 CAGAACATGAGGAGACAGGGAGG - Intergenic
1160829531 19:1096975-1096997 CAGCACTTTGGGAAGCTGAGAGG + Intergenic
1161469573 19:4449495-4449517 CAGAGCACGTGGATGCAGAGAGG + Intronic
1161515936 19:4696510-4696532 CAGCACTTTGGGAAGCCGAGGGG + Intronic
1161651518 19:5488595-5488617 CAGCACTTTGGGAAGCTGAGTGG - Intergenic
1161654152 19:5503372-5503394 CAGCACTTTGGGAAGCCGAGTGG - Intergenic
1161905807 19:7155662-7155684 CAGAACTTTGGGAGGCTGAGGGG + Intronic
1162111233 19:8400831-8400853 CAGCACTTTGGGAAGCCGAGAGG - Intronic
1162904171 19:13813670-13813692 CAGCACTTTGGGAAGCTGAGGGG + Intronic
1163059090 19:14745156-14745178 CAGCACTTTGGGAAGCTGAGGGG - Intronic
1163729854 19:18942536-18942558 CAGGACTTTGGGAAGCCGAGGGG - Intergenic
1163784170 19:19266152-19266174 CAGCACAAGGAGAAGCACAGAGG - Intronic
1163941579 19:20500084-20500106 CAGCACTTTGGGAGGCAGAGGGG - Intergenic
1164821487 19:31254632-31254654 CAAAATGTGGGAAAGCAGAGAGG - Intergenic
1165128471 19:33617670-33617692 CAGAAAAGGGGAAAGGAGAGAGG + Intergenic
1165265888 19:34663810-34663832 AAGAAGATGGAGATGCAGAGGGG + Intronic
1165359166 19:35323961-35323983 CAGCACTTTGGGAAGCAAAGTGG - Intronic
1165481101 19:36064826-36064848 CAGCACTTTGGGAGGCAGAGGGG - Intronic
1165639818 19:37374863-37374885 GAGTACAGGTGGAAGCAGAGAGG + Intronic
1165710841 19:38009772-38009794 AAGCAGATGGGGAAGCAGTGTGG - Intronic
1166166176 19:40990639-40990661 CAGCACGTTGGGAAGCTGAGGGG - Intergenic
1166524628 19:43503553-43503575 CAGCACTTGGGGAGGCCGAGGGG - Intronic
1166723086 19:45008829-45008851 CAGGACAAGGGGAAGCCCAGAGG - Intronic
1166844612 19:45718996-45719018 CAGCACTTTGGGAGGCAGAGGGG + Intronic
1167139403 19:47639254-47639276 CAGCACTTTGGGAGGCAGAGAGG - Intronic
1167223345 19:48218600-48218622 CAGAACTTTGGGAGGCCGAGGGG - Intronic
1167284791 19:48592903-48592925 CATTGCATGGGGAAGCGGAGGGG - Intronic
1167331404 19:48858847-48858869 CAGAACACAGGTGAGCAGAGAGG - Exonic
1167574279 19:50310292-50310314 CAGAAATGGGGGAAGGAGAGTGG - Exonic
1168010021 19:53522481-53522503 CAGAACTTTGGGAAGCCGACGGG - Intronic
1168517874 19:57023463-57023485 AAGAACATGTGGACACAGAGAGG - Intergenic
925344710 2:3162673-3162695 CGGAACATAGAGAGGCAGAGTGG + Intergenic
925682076 2:6432939-6432961 CAGCACTTTGGGAGGCAGAGGGG + Intergenic
925812773 2:7717280-7717302 CAGCACTTTGGGAGGCAGAGGGG - Intergenic
926297496 2:11579227-11579249 CTGGGCATGGGGAAGCAGTGAGG - Intronic
926979368 2:18551422-18551444 TAGAACAAGAGGAAGCAGAAGGG + Intergenic
927140638 2:20128444-20128466 CAGCACCTTGGGAAGCTGAGGGG - Intergenic
927143028 2:20142565-20142587 CATAACATGGGTAAGCAGAGCGG - Intergenic
927262454 2:21106069-21106091 CAGCACTTTGGGAAGCCGAGGGG + Intergenic
927538174 2:23881607-23881629 CAGCACATTGGGAGGCCGAGGGG - Intronic
927705555 2:25294391-25294413 CAAAACATGAGGAGACAGAGTGG + Intronic
927754917 2:25701008-25701030 CAGCACTTTGGGAGGCAGAGAGG - Intergenic
928379494 2:30805356-30805378 GAGAAAAAGGGGAAGCAGTGAGG - Intronic
928425293 2:31172707-31172729 CAGAAGATGGGGAAGCGTGGTGG + Intergenic
928478396 2:31654957-31654979 CAGAACTTGGAGAAGAAGAAAGG - Intergenic
928544734 2:32319037-32319059 CAGCACTTTGGGAGGCAGAGGGG + Intergenic
929606135 2:43235538-43235560 CAGCACTTTGGGAAGCCGAGGGG - Intronic
929736560 2:44556017-44556039 CAAGACATGGGGCAGCAGAAAGG + Intronic
930113648 2:47700412-47700434 CAGCACTTTGGGAGGCAGAGGGG - Intronic
930206540 2:48592707-48592729 CAGCACTTGGGGAGGCCGAGAGG - Intronic
932090082 2:68798753-68798775 CAGAAAAGGGGGAAGCAGAATGG + Intronic
932434263 2:71694036-71694058 CAGATCATGGGGCAGCAGCAAGG + Intergenic
932448464 2:71794836-71794858 CTGAGCATGGGGAAGCTCAGAGG + Intergenic
932766035 2:74470770-74470792 CAGCACTTTGGGAAGCCGAGGGG + Intergenic
933185291 2:79271456-79271478 CAGAAGTTGGGGAATCAGAGTGG + Intronic
933262815 2:80149285-80149307 CAGAACTTTGGGAAGCTGAGTGG - Intronic
934941720 2:98507729-98507751 ATGGACATGGGTAAGCAGAGGGG + Intronic
935727040 2:106032500-106032522 CAGCACTTTGGGAGGCAGAGGGG + Intergenic
936866667 2:117082317-117082339 CAGCACATGGGGCAGAATAGGGG - Intergenic
936881444 2:117256031-117256053 CAGAACAGAGGAAAGCAAAGAGG + Intergenic
938675578 2:133630304-133630326 AGGAACATGGGGACACAGAGAGG + Intergenic
938899665 2:135789456-135789478 AAGGAGATGGGGCAGCAGAGAGG + Intronic
938989431 2:136612730-136612752 CAGAACATTGTGAAGGGGAGAGG + Intergenic
939168655 2:138667655-138667677 CAGAATATGGGGTAGGAGATTGG + Intergenic
939198409 2:139002638-139002660 CAGAAGATGGGAAAGCAAGGAGG + Intergenic
939475943 2:142686576-142686598 CAGCACTTTGGGAAGCAGGGTGG - Intergenic
939513758 2:143140808-143140830 GAGAACAAGGTGCAGCAGAGGGG + Intronic
939786661 2:146522024-146522046 CAGAACTTGGGGAAAAAGAGAGG - Intergenic
940111926 2:150164115-150164137 CGGAACTTGGGAAAGCAGGGAGG + Intergenic
940557692 2:155252233-155252255 CAGAACTTTGGGAGGCCGAGAGG - Intergenic
941411233 2:165159609-165159631 CAGCACTTTGGGAAGCTGAGAGG - Intronic
941745118 2:169079093-169079115 CAGCACTTTGGGAGGCAGAGGGG - Intronic
941990102 2:171547321-171547343 CAGAAGGTGAGGAAACAGAGTGG + Intronic
942771967 2:179532276-179532298 CAGAACATATAGAGGCAGAGAGG - Intronic
942807237 2:179946193-179946215 CAGCACTTTGGGAAGCAGAGGGG + Intronic
943455057 2:188095849-188095871 CAGAACATTGGGCACCAGTGAGG - Intergenic
943908291 2:193529325-193529347 CAGTACTTTGGGAAGCTGAGGGG - Intergenic
944229039 2:197375116-197375138 CAGAAAATGGCTGAGCAGAGGGG + Intergenic
944751006 2:202709448-202709470 CAGTACTTTGGGAGGCAGAGGGG - Intronic
945246554 2:207722710-207722732 CAGAACTTTGGGAGGCCGAGGGG + Intronic
945280413 2:208030507-208030529 CAGCACTTTGGGAAGCAGAGTGG - Intergenic
946056769 2:216909784-216909806 CAGCAGATGGGGAAACAGAAGGG - Intergenic
946060150 2:216934487-216934509 GAGAACATGGGGAGGGAAAGGGG - Intergenic
946228935 2:218279814-218279836 CAAAACATGGTCAAGAAGAGAGG + Intronic
946359629 2:219211258-219211280 GAGAAGATGGGGAAACAGAGAGG - Intronic
947430331 2:230022244-230022266 GAGAACAAGGGGAAGCAGCGAGG - Intergenic
947537556 2:230950073-230950095 CAGCACTTGGGGAGGCCGAGAGG - Intronic
948684606 2:239662529-239662551 CAGGAAATGGAGGAGCAGAGTGG - Intergenic
1169147411 20:3261931-3261953 CAGAAAATGTGGAAGGAGGGTGG + Intronic
1170203341 20:13768646-13768668 CAGCACTTTGGGAGGCAGAGGGG + Intronic
1170540126 20:17379245-17379267 CAAGACATGGGCAAGCAGTGTGG - Intronic
1170851062 20:20004960-20004982 CAGAAATTTGGGAAGCTGAGGGG - Intergenic
1172259564 20:33550869-33550891 CAGCACTTTGGGAAGCCGAGAGG - Intronic
1172644735 20:36462241-36462263 CAAACCAGGGGAAAGCAGAGAGG - Intronic
1173202958 20:40967422-40967444 CAGAACTTTGGGAGGCTGAGTGG + Intergenic
1173505292 20:43582303-43582325 CAGCACTTTGGGAAGCTGAGGGG - Intronic
1173634355 20:44541935-44541957 CAGCACTTTGGGAAGCCGAGGGG - Intronic
1174000736 20:47372727-47372749 CAGAACATGGGGCAGGGCAGAGG - Intergenic
1174447923 20:50602729-50602751 GAGAACATGGGCATGCACAGCGG - Intronic
1175018029 20:55812830-55812852 CAGTACATGTGTAAGCAGTGGGG + Intergenic
1175072383 20:56345345-56345367 GAGAACATGGAGAAGCTGAGTGG + Intergenic
1175175121 20:57106885-57106907 CAGAACATGGAGGAAGAGAGAGG - Intergenic
1175201328 20:57279773-57279795 CAGCACTTTGGGAGGCAGAGGGG + Intergenic
1175965794 20:62659624-62659646 CACAAAGTGGGGAGGCAGAGCGG + Intronic
1176128997 20:63488353-63488375 AAGAACGTGGAGAAGAAGAGCGG - Exonic
1176777428 21:13151040-13151062 AAGAAAATGGGGAAGATGAGTGG - Intergenic
1176861254 21:14012689-14012711 CAGAGCAGGGGTAAGGAGAGGGG - Intergenic
1176923824 21:14722270-14722292 GAGAACATGTGGACACAGAGAGG - Intergenic
1177321788 21:19531371-19531393 CAGAACTTTGGGAGGCCGAGGGG + Intergenic
1178024505 21:28451086-28451108 CAGCACTTTGGGAAGCTGAGGGG - Intergenic
1178390543 21:32194409-32194431 CAGTACTTTGGGAAGCTGAGTGG + Intergenic
1178422944 21:32456611-32456633 GAGAACATGGTGACTCAGAGAGG + Intronic
1179149176 21:38795693-38795715 CAGACCATGGGGAAGAGGCGTGG - Intergenic
1179317315 21:40255286-40255308 CATAACATGGGGTTGCAGAGCGG - Intronic
1179476702 21:41651203-41651225 AAGAACCTGGGGATGAAGAGGGG - Intergenic
1179653067 21:42827184-42827206 CAGAACTTTGGGAGGCTGAGGGG + Intergenic
1179827696 21:43976446-43976468 CAGCACTTCGGGAAGCCGAGGGG - Intronic
1182485754 22:30637636-30637658 CAGAACTTCAGGAAGCTGAGGGG - Intronic
1182580492 22:31306612-31306634 CAGAACTTTGGGGAGCTGAGGGG - Intergenic
1183151505 22:36041448-36041470 CAGCACTTTGGGAAGCTGAGGGG + Intergenic
1183206849 22:36425507-36425529 CAGCACTTTGGGAGGCAGAGGGG + Intergenic
1183307228 22:37089184-37089206 CAGAAGCCTGGGAAGCAGAGAGG + Intronic
1183742266 22:39675373-39675395 CAGAGCATGGGGAAGGGGAGAGG - Intronic
1184100496 22:42339579-42339601 CAGCACATGCTGACGCAGAGTGG - Intronic
1184166721 22:42733639-42733661 CAGCACTTTGGGAAGCTGAGGGG + Intergenic
1184411116 22:44327080-44327102 CTGAATATGGGGAAGCAGATCGG + Intergenic
1184600305 22:45539445-45539467 CAGCACTTTGGGAAGCCGAGGGG - Intronic
1184756310 22:46517850-46517872 CAGAATATGGGGACACAGGGTGG - Intronic
1185032254 22:48450281-48450303 CTGGAGCTGGGGAAGCAGAGAGG + Intergenic
949379970 3:3433557-3433579 CAGAAGAGGGAGAAGAAGAGAGG + Intergenic
950018747 3:9771271-9771293 CAGAACCTTGGGAAGCTGATTGG - Intronic
950115142 3:10445902-10445924 CAGAAGATGGCCAAGCAGGGTGG + Intronic
950623591 3:14227439-14227461 AAGAACATGGGATATCAGAGTGG + Intergenic
952321765 3:32284333-32284355 AAGAACAGGAGGAAGCAGTGAGG + Intronic
953225983 3:41021384-41021406 CAGCACTTTGGGAAGCCGAGGGG - Intergenic
953648347 3:44775831-44775853 CAGCACTTTGGGAAGCTGAGGGG + Intronic
953779763 3:45857321-45857343 GAGAACATGTGGACACAGAGGGG + Intronic
953992896 3:47497674-47497696 CAGCACTTTGGGAAGCAAAGGGG + Intronic
954007510 3:47603526-47603548 AAGCACATGGGGAACCACAGAGG - Intronic
954117228 3:48473576-48473598 GAGAACATGGGGAGACAGATTGG - Intronic
954255105 3:49399684-49399706 CAGCACTTGGGGCAGCTGAGGGG - Intronic
954363580 3:50134821-50134843 CAGCAGCTGGGCAAGCAGAGGGG + Intergenic
954376956 3:50200107-50200129 CAGCACTTTGGGAGGCAGAGGGG + Intergenic
954430338 3:50467463-50467485 CAGTAGATGGAGAAGCAAAGCGG - Intronic
954658105 3:52209926-52209948 CAGAACTTTGGGAGGCCGAGGGG - Intronic
954852709 3:53617071-53617093 CAGGACTTGGAAAAGCAGAGAGG - Intronic
955475175 3:59329032-59329054 AAGAAGATGGGGAAACACAGAGG + Intergenic
955756819 3:62233345-62233367 GAGAGCATGGGGAAGGAGAGGGG - Intronic
956059078 3:65331694-65331716 CAGAACCTAGGTAAGGAGAGAGG + Intergenic
956418089 3:69054265-69054287 CAGCACTTTGGGAAGCCGAGGGG + Intergenic
956986666 3:74709123-74709145 CAGTACTTTGGGAAGCCGAGGGG - Intergenic
957235874 3:77590295-77590317 CAAATTATGAGGAAGCAGAGAGG - Intronic
957311558 3:78526157-78526179 CAGAGGCTGGGGAAGGAGAGGGG - Intergenic
957680606 3:83428446-83428468 CAGAACTTTGGGAGGCCGAGGGG + Intergenic
957697497 3:83659964-83659986 CAGCACTTTGGGAAGCTGAGGGG + Intergenic
957757053 3:84503834-84503856 CAGAACTTTGGGAGGCCGAGCGG + Intergenic
957888499 3:86323777-86323799 GAGAACATGTGGACACAGAGAGG + Intergenic
957927185 3:86829209-86829231 CAGGACCTGGGGAAGTAGAAAGG - Intergenic
958704677 3:97640520-97640542 CAGCACTTTGGGAAGCCGAGGGG + Intronic
960264996 3:115611057-115611079 CATCACATGGGGTATCAGAGAGG - Intergenic
960474409 3:118106816-118106838 AAGAAAATGGTGAAGCAGGGAGG - Intergenic
960707810 3:120497381-120497403 CAGAAAAGGGGGAAGGTGAGTGG - Intergenic
960811504 3:121631576-121631598 CAGAGCTTGGGGTGGCAGAGAGG + Exonic
960991220 3:123312951-123312973 CTGAACATGGGGCAGGAGGGAGG + Intronic
961235184 3:125360199-125360221 TAGAACATGGAGAAGCTGATAGG - Intronic
961422554 3:126817847-126817869 TAGAAAATGGGGAAGAAGAAGGG - Intronic
961431029 3:126883220-126883242 CAGAACTCGGGGAAACACAGAGG - Intronic
961623848 3:128245502-128245524 CTGGACAGGGAGAAGCAGAGTGG + Intronic
961692907 3:128683108-128683130 CAGCACTTGGGGAGGCCGAGGGG - Intergenic
962040164 3:131698661-131698683 CAGCACTTTGGGAAGCCGAGGGG + Intronic
962206680 3:133440633-133440655 CAGAACTTGGGGGGACAGAGAGG + Intronic
962311754 3:134331773-134331795 CTGAACAAGGGGTAGCATAGGGG - Intergenic
962409396 3:135128208-135128230 CATTACAAGGGGGAGCAGAGAGG - Intronic
962626993 3:137235648-137235670 GAGAACATGGGGAAGGAGTTGGG + Intergenic
962789253 3:138795961-138795983 CAGAACTTCATGAAGCAGAGAGG - Intronic
962804567 3:138917526-138917548 CAGCACTTTGGGAGGCAGAGCGG - Intergenic
963005779 3:140725068-140725090 CAGAACCCTGTGAAGCAGAGAGG - Intergenic
964069374 3:152612995-152613017 CAGAACTTAGGGAAGAAAAGGGG + Intergenic
965024012 3:163274975-163274997 CAGTACTTTGGGAGGCAGAGAGG - Intergenic
965202378 3:165676412-165676434 CAGAACTTTGGGAGGCCGAGGGG + Intergenic
965593126 3:170381073-170381095 CAGCACTTTGGGAGGCAGAGTGG - Intronic
965635992 3:170781248-170781270 CAGAACAGGAGAAGGCAGAGAGG - Intronic
966950055 3:184808220-184808242 CAGAGCCTTGGGAAGCAGTGAGG - Intergenic
967214424 3:187198535-187198557 CATAAGATGGGGAGGCTGAGTGG + Intronic
967293633 3:187945190-187945212 AAGATCATGAGGAAGCAGAAGGG + Intergenic
967380296 3:188850180-188850202 GAGAAAACGGGGAAGCTGAGAGG + Intronic
967550045 3:190782170-190782192 CAGCACTTTGGGAGGCAGAGTGG - Intergenic
967618705 3:191605036-191605058 CAGCACTTGGGGAGGCTGAGGGG - Intergenic
967927023 3:194658393-194658415 CAGCACTTTGGGAAGCCGAGAGG - Intronic
968447994 4:662117-662139 CAGGACCTGGGGGAGCCGAGAGG - Exonic
968763695 4:2457189-2457211 CAGCGCGTGGGGAAGCTGAGGGG - Intronic
968866301 4:3214176-3214198 AAAAACATGGTGAAGCAGACAGG - Intronic
969174854 4:5390657-5390679 CAGGACATAGGAAAGCAGGGAGG + Intronic
970466239 4:16325855-16325877 CAGAAAAAGCAGAAGCAGAGAGG + Intergenic
970877883 4:20893670-20893692 CAGCACTTTGGGAAGCTGAGTGG - Intronic
971127209 4:23767170-23767192 CAGCACTTTGGGAAGCCGAGGGG - Intronic
971153508 4:24058696-24058718 CAGCACTTTGGGAGGCAGAGTGG + Intergenic
971269177 4:25122835-25122857 GAGCACATGGGCAAGTAGAGGGG + Exonic
971324492 4:25633105-25633127 CAGCACTTTGGGAGGCAGAGGGG - Intergenic
971562539 4:28099877-28099899 CAGCACTTTGGGAGGCAGAGGGG - Intergenic
973248108 4:48031985-48032007 CAGCACTTTGGGAGGCAGAGGGG - Intronic
973968386 4:56186680-56186702 GAGAACCTGAGGCAGCAGAGAGG - Intronic
973977473 4:56277023-56277045 CAGGACATGGAGTAGCTGAGAGG + Intronic
974097144 4:57375857-57375879 TAGAACATGGGATAGAAGAGGGG - Intergenic
974731542 4:65873166-65873188 CAGCACTTTGGGAAGCCGAGAGG + Intergenic
975613948 4:76228227-76228249 CAGCACTTGGGGAGGCTGAGGGG + Intronic
975792628 4:77971130-77971152 GAGAACATGTGGACACAGAGAGG + Intergenic
975966925 4:79985098-79985120 CAGCACTTTGGGAAGCCGAGGGG + Intronic
976308851 4:83589841-83589863 CAGCACTTTGGGAAGCCGAGTGG + Intronic
976655296 4:87482301-87482323 CCGGGCATGGGGAAGCATAGTGG + Intronic
976674223 4:87686458-87686480 CAGAACATTGGGAGGCCGAGCGG - Intergenic
976805493 4:89041670-89041692 CAGCACTTTGGGAAGCCGAGGGG + Intronic
977401461 4:96537742-96537764 AAGATCATGGGGAAGGGGAGGGG - Intergenic
977510657 4:97958058-97958080 CAGTACTTTGGGAGGCAGAGGGG + Intronic
978624053 4:110664481-110664503 CAGAGAAAGGGGAAGCAGTGAGG - Intergenic
978806955 4:112810797-112810819 CAGCACTTTGGGAAGCCGAGGGG - Intergenic
978819777 4:112952871-112952893 TAGGAAATGGGGAAACAGAGAGG + Intronic
979025312 4:115565021-115565043 CAGACAATGGTGAAGCACAGAGG + Intergenic
979525704 4:121714349-121714371 CAGCACTTTGGGAAGCAGAGTGG + Intergenic
980717548 4:136647020-136647042 CAGCACATTGGGAGGCAGAGCGG - Intergenic
981278448 4:142929317-142929339 AAGAACATTGAGAAGAAGAGAGG - Intergenic
981602863 4:146510505-146510527 CAGCACTTTGGGAAGCTGAGGGG - Intronic
982002227 4:151031533-151031555 CAGCACTTTGGGAGGCAGAGGGG + Intergenic
982085318 4:151829724-151829746 TGGTACATGTGGAAGCAGAGAGG - Intergenic
983058493 4:163127742-163127764 CAGCTCATGGGGAAGAAAAGTGG + Intronic
983335628 4:166388383-166388405 CAGCACTTTGGGAAGCTGAGGGG - Intergenic
983710719 4:170712653-170712675 CAGCACTTTGGGAAGCCGAGAGG + Intergenic
984270959 4:177548290-177548312 CTGAATATGTGGAAGCTGAGAGG + Intergenic
984813155 4:183813133-183813155 CAGCACTTTGGGAAGCCGAGGGG + Intergenic
985135788 4:186784626-186784648 CAGGAACTGGGGAAGCAGCGTGG - Intergenic
985245051 4:187971942-187971964 CAGCACTTTGGGAGGCAGAGGGG + Intergenic
985404478 4:189623717-189623739 CAGCACATGTGGAGGCAGTGGGG - Intergenic
985587963 5:750737-750759 CAGCCCATGGGGAGGGAGAGTGG - Intronic
985602632 5:843204-843226 CAGCCCATGGGGAGGGAGAGTGG - Intronic
986016256 5:3760109-3760131 CAGCACTTTGGGAAGCTGAGGGG + Intergenic
986026103 5:3852867-3852889 GAGGACATGGCGCAGCAGAGGGG - Intergenic
986671329 5:10145592-10145614 CAGAAGATGGGGAAGAGGGGAGG + Intergenic
986898030 5:12394646-12394668 CAGCACTTTGGGAGGCAGAGGGG + Intergenic
987303819 5:16619151-16619173 GAGAACATGGGGCAGGAGAGAGG + Intergenic
989007708 5:36833665-36833687 CAGCACTTTGGGAAGCCGAGGGG + Intergenic
989686815 5:44098948-44098970 GAGAAAATGGCCAAGCAGAGAGG + Intergenic
991184320 5:63789478-63789500 GAGAACATGAGAAAGCAGAGAGG + Intergenic
991271096 5:64782197-64782219 CAGCACTTTGGGAAGCCGAGGGG + Intronic
991356879 5:65777824-65777846 CAGAAAATAGGGAAACAGATGGG + Intronic
991686665 5:69188317-69188339 CAGCACTTTGGGAAGCCGAGGGG - Intergenic
992190219 5:74284679-74284701 CAGAGCATCAGGAAGCAGGGTGG - Intergenic
992242395 5:74785511-74785533 CAGCACACTGGGAGGCAGAGGGG + Intronic
993027101 5:82660003-82660025 CAAAAGCTGAGGAAGCAGAGTGG - Intergenic
993044553 5:82852641-82852663 CAGCACTTTGGGAAGCTGAGGGG + Intergenic
993056838 5:82991216-82991238 CAGCCCAGAGGGAAGCAGAGCGG - Intergenic
993435910 5:87893932-87893954 AAGAAGATGGGGAAGCAGTTAGG - Intergenic
993788273 5:92172201-92172223 CAGCACTTTGGGAAGCTGAGGGG - Intergenic
994165498 5:96604011-96604033 CAGCACTTTGGGAAGCTGAGGGG - Intronic
994545531 5:101162510-101162532 CAGCACTTGGGGAGGCTGAGGGG + Intergenic
994801623 5:104384163-104384185 CAGAACTTTGGGAGGCTGAGCGG - Intergenic
994972274 5:106755686-106755708 CACCACTTGGGGAGGCAGAGGGG + Intergenic
995023214 5:107389880-107389902 CAGAAAATGAGGAAGTAGTGGGG - Intronic
995818332 5:116197628-116197650 CAGAACGTAGGGAGGCCGAGGGG - Intronic
995951234 5:117716265-117716287 GAGAACCTGGGGGAGCAGTGGGG + Intergenic
996774478 5:127119223-127119245 CACTACATGTGGAAGAAGAGTGG + Intergenic
997000380 5:129752523-129752545 GAGAACATGTGGACGCAGGGAGG + Intronic
997161678 5:131615650-131615672 CAGCACTTTGGGAGGCAGAGTGG + Intronic
997256976 5:132436308-132436330 CAGCACAGGTGGAAGCAGGGAGG + Intronic
997497305 5:134339899-134339921 CAAAACTATGGGAAGCAGAGAGG + Intronic
998937784 5:147249249-147249271 GAGAAAATGGGGGATCAGAGAGG - Intronic
999169322 5:149580307-149580329 CAGGACTTTGGGAAGCTGAGGGG - Intronic
999273793 5:150314718-150314740 CAGGACCTGGGGAAGAACAGAGG + Intronic
999371588 5:151058625-151058647 CAGAACTTGCAGAGGCAGAGAGG - Intronic
999979608 5:156945170-156945192 GAGACCAGGAGGAAGCAGAGTGG + Intronic
1001308641 5:170594757-170594779 CAGCACTTTGGGAGGCAGAGTGG - Intronic
1001415077 5:171540007-171540029 CAGCACTTTGGGAAGCAGGGGGG - Intergenic
1002100337 5:176854541-176854563 TGGACCCTGGGGAAGCAGAGGGG - Intronic
1002172772 5:177384648-177384670 CAGCACTTTGGGAAGCCGAGTGG + Intronic
1002470634 5:179433325-179433347 GAAAACATGGGCAAGAAGAGTGG - Intergenic
1002526878 5:179820033-179820055 CAGAACTGGGGCAAGGAGAGGGG - Intronic
1002799269 6:505598-505620 CAGCACCTGGGAATGCAGAGTGG - Intronic
1003146383 6:3513637-3513659 CAGAGGATGGGGAGGCAGAATGG + Intergenic
1003226004 6:4206245-4206267 CAGAGCATGGGGGAGCAATGTGG + Intergenic
1003535886 6:6975069-6975091 CAGCACTTTGGGAGGCAGAGGGG + Intergenic
1003626236 6:7744236-7744258 CAGCACTTGGGGAGGCCGAGGGG + Intronic
1003631480 6:7791498-7791520 ATGAAGATGGAGAAGCAGAGAGG - Intronic
1003681666 6:8263597-8263619 CAGCACTTTGGGAGGCAGAGGGG - Intergenic
1003831488 6:10017066-10017088 CAGCACTTTGGGAAGCCGAGAGG + Intronic
1004390480 6:15205461-15205483 CAGAACACTGGGAAGCCAAGGGG - Intergenic
1005044447 6:21628717-21628739 AAGGACAAGGGGAAGGAGAGTGG + Intergenic
1005833267 6:29687908-29687930 CAGCACTTTGGGAAGCTGAGCGG - Intergenic
1006133457 6:31882332-31882354 AAGAACATCCAGAAGCAGAGAGG + Intronic
1006189915 6:32201377-32201399 CTGAAGATGGGGACCCAGAGTGG - Exonic
1006287516 6:33107930-33107952 AAGAAAATGGAGAAGCAGAGAGG - Intergenic
1006510205 6:34517328-34517350 CAGACCATGGTGGGGCAGAGTGG - Intronic
1007614008 6:43170044-43170066 CAGCACTTTGGGAAGCCGAGGGG + Intergenic
1007727928 6:43927889-43927911 CAGAGCCCGGTGAAGCAGAGGGG + Intergenic
1007741302 6:44011191-44011213 GAGAAAATGGGGATTCAGAGAGG + Intergenic
1007784598 6:44272399-44272421 CAGAACATGGGGAATGAGACTGG + Intronic
1007791086 6:44308848-44308870 CAGCACTTGGGGAGGCAGAGGGG - Intronic
1007956916 6:45926502-45926524 CAGCACTTTGGGAAGCCGAGGGG - Intronic
1008007442 6:46426145-46426167 CAGCACTTTGGGAAGCTGAGGGG - Intronic
1008352609 6:50510348-50510370 CATAGCATTGGGAAGAAGAGTGG - Intergenic
1009964600 6:70565428-70565450 CAGCACTTTGGGAAGCTGAGAGG + Intergenic
1010026984 6:71230331-71230353 CAGCACTTTGGGAAGCTGAGGGG - Intergenic
1010370679 6:75103476-75103498 CAGAACATGGGGAAGCAGAGGGG - Intronic
1011209958 6:84944818-84944840 CGGAACATGGGCTAGCAGACTGG - Intergenic
1012556744 6:100522590-100522612 CAGAGACAGGGGAAGCAGAGTGG + Intronic
1012668516 6:102010629-102010651 CAGCACTTGGGGAGGCAGAGGGG - Intronic
1012902001 6:105017393-105017415 CAGCAGATAGGGAAGCAGACTGG + Intronic
1012934609 6:105353520-105353542 CAGCACTTTGGGAAGCCGAGTGG + Intronic
1013112648 6:107076704-107076726 CATGGCTTGGGGAAGCAGAGAGG + Intronic
1013128029 6:107204187-107204209 CAGCACTTTGGGAAGCCGAGGGG - Intronic
1013535477 6:111059504-111059526 CAGAACAGTGGGAGGGAGAGAGG - Intergenic
1013988010 6:116219706-116219728 CAGCACTTTGGGAGGCAGAGTGG + Intronic
1014368895 6:120580352-120580374 GAGAACATGTGGACACAGAGAGG - Intergenic
1014924374 6:127253701-127253723 CAGAACTTTGGGAGGCTGAGTGG + Intergenic
1015009710 6:128330743-128330765 CAGATCATGTTGAAGCTGAGGGG - Intronic
1015036487 6:128661666-128661688 GAGAACATAGGGACACAGAGAGG + Intergenic
1015748337 6:136534933-136534955 CCGTACATGGGGATGGAGAGAGG + Intronic
1016831603 6:148439528-148439550 CAGCACTTTGGGAAGCTGAGGGG + Intronic
1017731613 6:157322377-157322399 CAGCACTTTGGGAAGCCGAGAGG - Intronic
1018176715 6:161183848-161183870 GGGGACATGGGGAAGCAGGGAGG + Intronic
1018490673 6:164289403-164289425 CAGAACATGGAAAAGCAAAATGG - Intergenic
1019147538 6:169984765-169984787 CAGGACACGTGGGAGCAGAGAGG - Intergenic
1019377985 7:706075-706097 CAGCACTTTGGGAAGCCGAGTGG + Intronic
1019416638 7:930568-930590 CAGAACTTTGGGAGGCCGAGGGG + Intronic
1019823309 7:3262557-3262579 CCACACATGGGGAAGCAGACAGG - Intergenic
1020734750 7:11934033-11934055 CAGCACTTGGGGAGGCTGAGGGG + Intergenic
1020842189 7:13232417-13232439 TAGAAACTGGGGAGGCAGAGTGG + Intergenic
1020883668 7:13795468-13795490 CAGATGATGGGGAAGGAAAGGGG - Intergenic
1022046208 7:26624526-26624548 CAGAGAATGGGGAAGCAGAGTGG + Intergenic
1022086972 7:27077924-27077946 CAGAACTTTGGGAGGCTGAGCGG + Intergenic
1022369494 7:29757427-29757449 AAGAAGATGAAGAAGCAGAGAGG - Intergenic
1022998361 7:35782343-35782365 CAGCACTTTGGGAGGCAGAGCGG + Intergenic
1023316209 7:38940109-38940131 CAGAACTTTGGGAGGCTGAGGGG + Intergenic
1023379023 7:39587303-39587325 CAGCACATTGGGAGGCTGAGAGG - Intronic
1023628069 7:42136540-42136562 CAAAACATGGGGGTACAGAGAGG + Intronic
1023715743 7:43042456-43042478 TAGACCATGGGGAATCTGAGGGG - Intergenic
1023765255 7:43504560-43504582 CAGAAGTGGGGGAAGCAGACAGG - Intronic
1023892327 7:44401998-44402020 CAGAACATGAGGGAGGAGTGTGG - Intronic
1023898273 7:44453102-44453124 CAGCACTTTGGGAAGCTGAGGGG + Intronic
1024231257 7:47365513-47365535 CAGCACTTTGGGAAGCCGAGGGG + Intronic
1024643065 7:51347525-51347547 CAGAACTTAGGGAAGCCAAGGGG - Intergenic
1024923486 7:54586913-54586935 CAGCACTTTGGGAGGCAGAGGGG + Intergenic
1025012183 7:55406380-55406402 CAGAAGATGGGGGAGCAGTCAGG + Intronic
1025214528 7:57044735-57044757 CAGCACTTTGGGAGGCAGAGGGG - Intergenic
1025321214 7:58096018-58096040 AAGAAAATGGGGAAGATGAGTGG - Intergenic
1025657425 7:63532077-63532099 CAGCACTTTGGGAGGCAGAGGGG + Intergenic
1026639532 7:72111997-72112019 TAGCACTTTGGGAAGCAGAGGGG - Intronic
1026816405 7:73515894-73515916 CAGCACTTTGGGAGGCAGAGGGG + Intronic
1027426038 7:78062293-78062315 CAGAACATGGGGAGGCATGTGGG + Intronic
1027603874 7:80275108-80275130 CAGCACTTTGGGAAGCCGAGGGG - Intergenic
1027789330 7:82619566-82619588 CAGAACTTTGGGAGGCTGAGGGG + Intergenic
1029056715 7:97752862-97752884 CAGCACATTGGGAGGCTGAGGGG - Intergenic
1029186702 7:98744236-98744258 CTGAACAGGAGGAAGCAGAAAGG - Intergenic
1029315631 7:99710700-99710722 CAGTACATGGAGAAGGAGGGAGG - Intronic
1029423663 7:100484107-100484129 CAGGACAAGGGGAAGGGGAGGGG + Intronic
1029614060 7:101645282-101645304 CAGAGCGTGGGGGTGCAGAGGGG + Intergenic
1029634445 7:101774591-101774613 CAGGACTTTGGGAGGCAGAGGGG + Intergenic
1030291443 7:107876764-107876786 CAGTACTTTGGGAAGCTGAGGGG - Intergenic
1030339171 7:108357706-108357728 CATGTCATGGGGATGCAGAGTGG + Intronic
1030871286 7:114759322-114759344 CAGAACATAGGGGAGCCAAGAGG - Intergenic
1031665565 7:124478758-124478780 CAGAACTTTGGGAGGCCGAGAGG + Intergenic
1031990204 7:128192651-128192673 GAGGACAAGGGGAAGAAGAGGGG - Intergenic
1032017316 7:128388429-128388451 CAGAAGAGGGAGAAGCAGAAAGG + Intergenic
1032447664 7:131998623-131998645 CAGGGCATGGAGAAGGAGAGGGG + Intergenic
1032486059 7:132288325-132288347 CAGAACTGGAGGAACCAGAGGGG - Intronic
1032846276 7:135754456-135754478 CAGGAGATGGGGTAGGAGAGAGG + Intergenic
1033325257 7:140372318-140372340 CAGAACTAGGGGAGACAGAGAGG + Intronic
1034745061 7:153516832-153516854 CAGAACTTTGGGAGGCCGAGGGG - Intergenic
1034797856 7:154029945-154029967 CAGCACTTTGGGAAGCTGAGGGG + Intronic
1034997331 7:155586506-155586528 CAGGACATGGGGGAGCTGATGGG - Intergenic
1035195565 7:157217586-157217608 CAGCACTTGGGGAAGCCGACGGG + Intronic
1036040542 8:5075628-5075650 CAGAACTTTGGGATGCTGAGAGG + Intergenic
1038392052 8:27211077-27211099 CAGAATCTGTGGATGCAGAGGGG - Intergenic
1038634208 8:29272312-29272334 CAGCACTTTGGGAAGCAGAGAGG + Intergenic
1038974424 8:32677406-32677428 CAGCACTTTGGGAAGCTGAGCGG + Intronic
1039486184 8:37911808-37911830 CAGCACTTTGGGAAGCCGAGGGG - Intergenic
1040286420 8:46102808-46102830 GAGAAAATGGGGCCGCAGAGTGG - Intergenic
1040294149 8:46140579-46140601 GAGAAAATGGGGCAGCAGAATGG - Intergenic
1041061448 8:54038631-54038653 CAGAACTTTGGGAGGCTGAGAGG - Intergenic
1041349688 8:56935919-56935941 CAGGACAGGGGCAAGCAGCGAGG + Intergenic
1041373414 8:57188743-57188765 CAAAACATGTGGAAGGGGAGTGG + Intergenic
1042134987 8:65624248-65624270 CAGTACCTTGGGAAGCTGAGGGG + Intronic
1042405248 8:68397250-68397272 CAGCACTTTGGGAAGCTGAGAGG - Intronic
1043814355 8:84783639-84783661 AAGGACCTGGGGAGGCAGAGTGG - Intronic
1043943597 8:86225021-86225043 CAAAAAATAGGGAAGCAGACTGG - Intronic
1044296168 8:90529863-90529885 CAGCACTTTGGGAAGCCGAGGGG - Intergenic
1044337719 8:91007195-91007217 CTGTACATGGAGAAGCAAAGTGG - Intronic
1044623103 8:94210070-94210092 CAGAAAATGGGGACACAGAGAGG + Intronic
1045750230 8:105475289-105475311 CATAACAATGAGAAGCAGAGAGG - Intronic
1045836430 8:106526789-106526811 CAGGACTTTGGGAGGCAGAGGGG - Intronic
1046477931 8:114773195-114773217 CTGAACAGGAGGAATCAGAGAGG + Intergenic
1046945916 8:119974148-119974170 CAGCACTTTGGGAAGCTGAGTGG + Intronic
1047192571 8:122691452-122691474 CAAAACATGGGAAAGCAGGATGG - Intergenic
1047541880 8:125775696-125775718 CAGAACTAGGTGAAGAAGAGAGG + Intergenic
1047834199 8:128670346-128670368 GAGGACATGAGGAAGGAGAGAGG - Intergenic
1048868562 8:138778732-138778754 CAGGTCATGGGGAGGCCGAGGGG - Intronic
1049187877 8:141268297-141268319 CAGGGCCTGGGGAAGAAGAGAGG + Intronic
1051094296 9:13448008-13448030 CAAAACATCTGGAAGAAGAGAGG - Intergenic
1051203599 9:14660115-14660137 CAGAACTTTGGGAGGCCGAGGGG + Intronic
1051446326 9:17142990-17143012 CTGAAAATGGGGCAGCAGGGAGG + Intronic
1051668565 9:19488235-19488257 CAGAACAAGGGGAAGCTGGTGGG - Intergenic
1051859979 9:21613380-21613402 CAGCACTTTGGGAAGCCGAGGGG - Intergenic
1052078570 9:24175303-24175325 CAGAGAATGGGGTATCAGAGAGG - Intergenic
1052306052 9:27010714-27010736 CAGCACTTTGGGAAGCCGAGGGG - Intronic
1052571113 9:30225487-30225509 CAGAACTTTGGGAGGCTGAGGGG + Intergenic
1052692659 9:31834959-31834981 CAGAACATATTGTAGCAGAGAGG + Intergenic
1053024412 9:34718329-34718351 GAGAGCATGGGGAGGGAGAGGGG - Intergenic
1053035818 9:34826138-34826160 GAGAGCATGGGGAGGGAGAGGGG - Intergenic
1055325103 9:75120606-75120628 CAGGTCATGAGGAAGCAAAGGGG - Intronic
1055528249 9:77156763-77156785 CAGAAGCTGGGGAAGGCGAGGGG + Intergenic
1055718594 9:79146251-79146273 GAGAAGCTGGGGAAGCAGATGGG - Intergenic
1056507819 9:87274141-87274163 CAGCACATTGGGAGGCCGAGGGG - Intergenic
1057107850 9:92437651-92437673 CAACACTTTGGGAAGCAGAGTGG - Intronic
1057860946 9:98640473-98640495 CAGGACCTGGGGCATCAGAGTGG - Intronic
1058139555 9:101342626-101342648 CAGGAGAGGGGGAAGGAGAGAGG + Intergenic
1059367291 9:113796681-113796703 CAGATGCTGGGGATGCAGAGGGG + Intergenic
1059808067 9:117826240-117826262 CAGAAGAAGGGGAAGTAGTGGGG + Intergenic
1060285493 9:122248031-122248053 CAGCACTTTGGGAAGCCGAGGGG - Intronic
1060525786 9:124320559-124320581 CAGGATCTGGGAAAGCAGAGGGG - Intronic
1061124673 9:128666950-128666972 CAGCACTTTGGGAAGCAGAGGGG + Intergenic
1061260073 9:129475337-129475359 CAGAGAATGGGGAGGGAGAGGGG + Intergenic
1061382654 9:130267691-130267713 CAGAACTCCTGGAAGCAGAGGGG - Intergenic
1061456875 9:130704970-130704992 CAGCACTTTGGGAAGCTGAGTGG + Intergenic
1061724363 9:132573746-132573768 CAGCACTTTGGGAAGCCGAGGGG - Intergenic
1062471500 9:136707667-136707689 CAGAACTTTGGGAGGCCGAGGGG + Intergenic
1062525217 9:136975536-136975558 TAGAAAATGGGGAAGAGGAGGGG + Intergenic
1062544676 9:137056092-137056114 GGGAACATGCGGATGCAGAGAGG + Intergenic
1185553468 X:1002245-1002267 CAGACCCTGGAGAAGGAGAGGGG + Intergenic
1185670315 X:1804379-1804401 CAGCACTTTGGGAAGCTGAGGGG - Intergenic
1186317735 X:8388813-8388835 CAGCACTTTGGGAGGCAGAGGGG + Intergenic
1186537071 X:10361060-10361082 CAGCACTTTGGGAGGCAGAGAGG + Intergenic
1186666554 X:11722628-11722650 CAGGCCTTGGGGAAGCTGAGGGG + Intergenic
1187144137 X:16622154-16622176 CAGCACTTTGGGAAGCTGAGAGG + Intronic
1187412758 X:19065020-19065042 CAGAACTTTGGGAAGCAAGGTGG + Intronic
1187442219 X:19330637-19330659 CAGCACTTTGGGAAGCTGAGGGG + Intergenic
1187532942 X:20112952-20112974 CAGAAGATGGGGCACCTGAGAGG + Intronic
1188238384 X:27755773-27755795 CAGCACTTTGGGAAGCTGAGGGG - Intergenic
1188699357 X:33239006-33239028 CAGAACTTTGGGAGGCTGAGGGG + Intronic
1188881041 X:35492336-35492358 CAGCACTTTGGGAAGCCGAGGGG - Intergenic
1189698778 X:43694637-43694659 GAGAAAATGAGGAAGCAAAGGGG - Intronic
1189921701 X:45908999-45909021 CAGCACTTTGGGAGGCAGAGTGG - Intergenic
1189937256 X:46082484-46082506 CAGATCTTGGGGAAGAATAGAGG - Intergenic
1190049008 X:47135416-47135438 CAGAACTTTGGGAGGCTGAGGGG - Intergenic
1190069254 X:47265999-47266021 CAGCACTTTGGGAAGCTGAGAGG - Intergenic
1190163154 X:48048654-48048676 CAGAACTTTGGGAGGCTGAGGGG + Intronic
1190291771 X:48997730-48997752 CAGAACAGGGAGAAGAGGAGGGG + Intronic
1190919165 X:54834499-54834521 GAGAACATATGGAAGCATAGAGG - Intergenic
1192183759 X:68931943-68931965 CACCAGATGGGAAAGCAGAGGGG - Intergenic
1192477282 X:71453753-71453775 CAGCACTTGGGGAGGCTGAGGGG + Intronic
1193038215 X:76976579-76976601 CAGAACATGGAGAAACAAACTGG + Intergenic
1193431995 X:81419115-81419137 CAGCAAAAGAGGAAGCAGAGAGG - Intergenic
1193656648 X:84206466-84206488 CAGTACATGAGGAAGGGGAGGGG + Intergenic
1193754765 X:85394929-85394951 CAGCACTTTGGGAAGCCGAGTGG - Intergenic
1194002334 X:88445989-88446011 AACAACTTGGTGAAGCAGAGAGG + Intergenic
1194113304 X:89865847-89865869 CAGAACTTTGGGAGGCAGAGGGG + Intergenic
1194192915 X:90858817-90858839 CAGAACAGGAGGAAGAAAAGGGG - Intergenic
1195044768 X:101045896-101045918 CAGCACTTTGGGAAGCTGAGGGG + Intronic
1195705116 X:107732847-107732869 CAGAACTTTGGGAAGCCAAGGGG + Intronic
1195839887 X:109163014-109163036 CAGAAGATGGGAAAGCTGTGAGG - Intergenic
1195963196 X:110406296-110406318 GAGAACACATGGAAGCAGAGAGG - Intronic
1195982495 X:110594253-110594275 CAGCACTTTGGGAAGCCGAGTGG - Intergenic
1196186346 X:112748674-112748696 TAGAAGTTGGGTAAGCAGAGAGG + Intergenic
1196324906 X:114391202-114391224 CAGAAGTTGGAGAAGAAGAGAGG + Intergenic
1196670612 X:118363145-118363167 CAGCACTTTGGGAGGCAGAGAGG + Intronic
1196797631 X:119515070-119515092 CAGTGCATTGGGAGGCAGAGCGG + Intergenic
1196832786 X:119789306-119789328 CAGCACTTTGGGAAGCCGAGAGG + Intronic
1196923928 X:120613172-120613194 CAGCACTTTGGGAGGCAGAGGGG - Intronic
1197212573 X:123840411-123840433 CAGCACTTGGGGAGGCCGAGGGG - Intergenic
1197350823 X:125381145-125381167 CAGCACTTTGGGAGGCAGAGGGG + Intergenic
1197704317 X:129622971-129622993 CAGAACCTGGGGCAGGGGAGAGG - Intergenic
1197967111 X:132076895-132076917 CAGAACATGGAAAAGGAGGGAGG - Intergenic
1198025448 X:132701598-132701620 GAGAAGATGGGGAAGCAGGTGGG - Intronic
1198382864 X:136100515-136100537 CAGAACTTTGGGAGGCTGAGTGG + Intergenic
1198911497 X:141620046-141620068 CCGAAGCTGGGGATGCAGAGAGG - Intronic
1200539539 Y:4441265-4441287 CAGAACAGGAGGAAGAAAAGGGG - Intergenic
1200781032 Y:7215862-7215884 CAGCACTTTGGGAGGCAGAGTGG + Intergenic
1200785527 Y:7257288-7257310 CAGAACATCTTGAAGCAAAGGGG + Intergenic
1200958446 Y:8973586-8973608 CAGGGCATGGGGACACAGAGGGG - Intergenic
1201245024 Y:11995063-11995085 CAGAGCCTGAGGAAGCAGAGAGG + Intergenic
1201706013 Y:16937885-16937907 CAGCACATTGGGAGGCTGAGGGG - Intergenic
1202162281 Y:21947939-21947961 AAGAAGAGAGGGAAGCAGAGAGG - Intergenic
1202229075 Y:22638434-22638456 AAGAAGAGAGGGAAGCAGAGAGG + Intergenic
1202314079 Y:23557731-23557753 AAGAAGAGAGGGAAGCAGAGAGG - Intergenic
1202556723 Y:26112864-26112886 AAGAAGAGAGGGAAGCAGAGAGG + Intergenic