ID: 1010375173

View in Genome Browser
Species Human (GRCh38)
Location 6:75160356-75160378
Sequence ATTGCTTTCACCTGAAACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 168}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010375173_1010375179 28 Left 1010375173 6:75160356-75160378 CCTGAGTTTCAGGTGAAAGCAAT 0: 1
1: 0
2: 1
3: 24
4: 168
Right 1010375179 6:75160407-75160429 GGAAGCATATGTGAAACTCTAGG No data
1010375173_1010375174 7 Left 1010375173 6:75160356-75160378 CCTGAGTTTCAGGTGAAAGCAAT 0: 1
1: 0
2: 1
3: 24
4: 168
Right 1010375174 6:75160386-75160408 ACATTCCCAAAATGCCCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010375173 Original CRISPR ATTGCTTTCACCTGAAACTC AGG (reversed) Intronic
901213624 1:7540795-7540817 ATTGCCAAAACCTGAAACTCTGG + Intronic
902357317 1:15914139-15914161 TGTACTTTCACATGAAACTCAGG - Intronic
907614303 1:55908116-55908138 TTTTCTTTCCCCTGAAACTGTGG - Intergenic
908579299 1:65497506-65497528 ATTGCTTTTACATGAATGTCAGG + Intronic
912388984 1:109288580-109288602 ATTGGTTCAACCTGAAACGCCGG - Intergenic
912632793 1:111261435-111261457 ATGGCTTTCACCTAAAAGACAGG - Intergenic
912754358 1:112312274-112312296 ACTGCTTTCCCCTCAAACTGTGG + Intergenic
916282560 1:163068267-163068289 ATAGCTTTCCTCTGTAACTCTGG + Intergenic
921225801 1:213017649-213017671 AATCCTTTCACCTCAAATTCTGG - Intergenic
922031353 1:221802633-221802655 ATTATTTTCACCTGAGAGTCAGG + Intergenic
923366687 1:233268659-233268681 ATTACTTTCTCCTGAGTCTCTGG - Intronic
923693081 1:236215813-236215835 ATTGCCTTCAGCTGAAAATTTGG - Exonic
924044397 1:240012394-240012416 ACTGCAGTCACCTGCAACTCCGG + Intergenic
1063005526 10:1966873-1966895 ATTGTTCTCAGCTGGAACTCCGG + Intergenic
1064745687 10:18475950-18475972 ATTGCTTTCACCTTACTCTATGG - Intronic
1064788194 10:18923215-18923237 ATTTCCTTCACTTGAACCTCTGG + Intergenic
1064918483 10:20488879-20488901 ATGGCTTTCACATTAAACACAGG + Intergenic
1068444832 10:57107830-57107852 ATTGCTTTTATCTGATATTCTGG - Intergenic
1069184051 10:65400305-65400327 ATTGCTTTCACAGGGAATTCTGG + Intergenic
1069188090 10:65452087-65452109 ATTGCTTAAACCTGAAAATCAGG - Intergenic
1069857334 10:71448580-71448602 ACAGCTTTCACCTGAAAGTCAGG + Intronic
1073629027 10:105129480-105129502 TTTTCTTTCACCTGAAGCTCTGG + Intronic
1074451094 10:113560178-113560200 TTTGCTTTCACCTGAAGCTCAGG - Intronic
1075011557 10:118874722-118874744 ACTGCTTTCATCTGAAACAGGGG + Intergenic
1076557660 10:131338741-131338763 ATTGCTTTTACATGGAATTCTGG - Intergenic
1078089658 11:8256982-8257004 ATTGCATTCATCTGGGACTCTGG - Intronic
1078964302 11:16320070-16320092 ATTTCTTTTAACTGAAACTGAGG + Intronic
1082932138 11:58619210-58619232 TTGGCTTTCACCTAAAATTCTGG + Exonic
1087324664 11:96706874-96706896 CTTCATTTAACCTGAAACTCAGG + Intergenic
1090001969 11:122969548-122969570 ATTATTCTCATCTGAAACTCAGG + Intergenic
1090633837 11:128675583-128675605 ATTGCTTTCCCCAAAATCTCTGG - Intergenic
1091883224 12:3996746-3996768 ATTCCTTTCATCAAAAACTCTGG + Intergenic
1092788459 12:12051049-12051071 AATGCTTTTAGATGAAACTCAGG + Intronic
1094201067 12:27794940-27794962 ATTGCTTTGACCTTCAACACTGG + Intronic
1094631987 12:32184688-32184710 AATCCTTTCGCCTGAAACTTTGG + Intronic
1099918847 12:88931761-88931783 ATTGCTTTCATCTGCAGCTTAGG + Intergenic
1102267974 12:111504949-111504971 ATTGCTTTCACCTTGCACTGCGG - Intronic
1103746867 12:123130848-123130870 ATTGCTTCTACCTGAAAAACTGG + Intronic
1104924952 12:132309175-132309197 GTAGATTTCACCTGAAACCCTGG + Intronic
1106499156 13:30310455-30310477 ATTGTTTTCACCAGATACTTTGG + Intergenic
1107672438 13:42759993-42760015 CCTGCTTTCACCTCAAATTCAGG - Intergenic
1108059268 13:46516303-46516325 ATGACTTTCACCTGGAAGTCTGG + Intergenic
1108127824 13:47263641-47263663 ATTGCTGTCACCAGGAACTCAGG - Intergenic
1109483433 13:62986773-62986795 ATTGCTTTATCCTGAAAATTTGG + Intergenic
1110371351 13:74744083-74744105 ATTACTTTGACCTGAAGCCCAGG + Intergenic
1110396364 13:75034099-75034121 ATTGCTCTCAGCTGTAACTCGGG + Intergenic
1113108166 13:106793228-106793250 ATTGCCTTAACCTGAAAGTTAGG - Intergenic
1114084869 14:19231567-19231589 ATGGTTTTCACCTGAGACCCGGG + Intergenic
1114466183 14:22924453-22924475 AGTGCTTTCCCCTCAATCTCAGG - Intronic
1114909902 14:27178292-27178314 TTTGCTTTCACTAAAAACTCAGG - Intergenic
1115290303 14:31764120-31764142 ATGGCTTACACCTCAAACTCTGG + Intronic
1115816418 14:37168993-37169015 CTTGCGTTCAACTGAAACTAGGG - Intronic
1117325766 14:54667694-54667716 ATTTGTTTCACCAGTAACTCAGG + Intronic
1119511679 14:75216443-75216465 ATTGCTTTTACTGGAAACTCAGG - Intergenic
1121425273 14:93846255-93846277 ATTGGTTTCACCTGAAAAGGTGG + Intergenic
1123027352 14:105432957-105432979 ATCGCTTTCGACTGAAGCTCAGG - Intronic
1123955893 15:25334009-25334031 AATGCTTTCCCCTTAAAATCAGG + Intronic
1126194084 15:45912319-45912341 ATGGCTTTCACCTGTAATCCAGG + Intergenic
1128039047 15:64554151-64554173 AATGCTTTCCCCTTAAAATCAGG - Intronic
1128069684 15:64787137-64787159 ATTCCTGTCACCTCAAACCCTGG + Intergenic
1128492222 15:68159538-68159560 ATTGCATTTACCTGACATTCTGG - Intronic
1128876228 15:71203571-71203593 ATTGCTTGAACCTTGAACTCAGG + Intronic
1131529925 15:93182336-93182358 AGGGCTTTCACCTGCAACACAGG - Intergenic
1131666592 15:94577467-94577489 ATTGCTTGCACCTGGATCACAGG - Intergenic
1131773244 15:95764034-95764056 ATTGCTGTCACCTGAGCCTTAGG - Intergenic
1132333831 15:101030473-101030495 ATTGCTCCCACCTGGAAGTCTGG + Intronic
1134618237 16:15668368-15668390 AGTCCTTCCACCTGAACCTCGGG + Intronic
1137554309 16:49461065-49461087 ATTCCTTTCCCTTTAAACTCAGG + Intergenic
1138742668 16:59328966-59328988 ATTGCTTTCATCTGAAGCTGCGG + Intergenic
1141068597 16:80933472-80933494 AGTGATTTCACCTAAAGCTCTGG - Intergenic
1148705634 17:49628779-49628801 AATGCTTTCAACTGAACCTACGG + Intronic
1149107377 17:52985769-52985791 CTTTCTTTCCCTTGAAACTCAGG + Intronic
1153167835 18:2282455-2282477 ATGGCTCACACCTGTAACTCTGG - Intergenic
1154392304 18:13948751-13948773 ATTCCTTTCACATGACATTCAGG - Intergenic
1158224955 18:55191216-55191238 GTTGCTTTCACCTGGACCCCAGG + Intergenic
1160437272 18:78861331-78861353 ATTGCTTTCACGCGTAAATCTGG + Intergenic
1161305940 19:3568112-3568134 TTTGCTTACAATTGAAACTCTGG + Intronic
1162712208 19:12603846-12603868 ATTTCTTCCACCTGTCACTCTGG - Intronic
1164873760 19:31668516-31668538 ATTGCTTTCCCCTTGAACTCGGG - Intergenic
926938522 2:18111603-18111625 ATTGCTTACTTCTGAAAATCAGG + Intronic
927394091 2:22629596-22629618 ATTTGTTTCTCCTGTAACTCAGG + Intergenic
928845855 2:35670842-35670864 ATGGCTTTTACCTAAAAGTCTGG - Intergenic
930213151 2:48664201-48664223 AATGCTTTCCCCTTAAAATCAGG - Intronic
930526775 2:52540548-52540570 TTGGCTTTGACCTGAACCTCAGG - Intergenic
932212984 2:69947350-69947372 ATTGCTTTCCCCTGAAAAACAGG + Intergenic
935627267 2:105181482-105181504 ATTGTTTTCACCAGGAAATCAGG - Intergenic
938584171 2:132672427-132672449 ATTACTATCACCTGAATCTCTGG + Exonic
939948372 2:148438336-148438358 AATGCTGTCACTTGAAACTCTGG + Intronic
940101641 2:150046774-150046796 AGTGCTTTTACCAGTAACTCAGG - Intergenic
940689110 2:156892720-156892742 AATGCTTTCACCTGCAAGTGAGG - Intergenic
941431703 2:165421844-165421866 ATTGCTTTTACCTGATTATCTGG - Intergenic
941679104 2:168377482-168377504 ATGGCTTTTACCTAAAAGTCAGG + Intergenic
943448889 2:188023740-188023762 ATTATTTTCTCTTGAAACTCAGG + Intergenic
946766897 2:223049369-223049391 ATTGCTGTCTCCTAAAACTGAGG + Intergenic
1170335201 20:15262717-15262739 ATTGCTTTTATCTAAAAGTCAGG - Intronic
1172317402 20:33966844-33966866 ATTGATTTCACCTGCAACAAAGG + Intergenic
1172956436 20:38762836-38762858 CTTGCTTTCACCTGTTACTTGGG + Intronic
1173598492 20:44275770-44275792 GTTGTTTTGACCTGAAATTCTGG - Intronic
1174578862 20:51556781-51556803 GTTTCTTTCCCCTGACACTCCGG - Intronic
1177654707 21:24002865-24002887 AGTGCTCTCACCAGAAATTCAGG + Intergenic
1178727124 21:35063604-35063626 ATTGATTTCACTTTAAACTCTGG + Intronic
1180293102 22:10861626-10861648 ATGGTTTTCACCTGAGACCCGGG - Intergenic
1180495907 22:15891048-15891070 ATGGTTTTCACCTGAGACCCGGG - Intergenic
949102834 3:166540-166562 ACTGCTTTTACTTGAAGCTCTGG - Intergenic
949982015 3:9508036-9508058 ATTGCTGTCATCTAAAACCCAGG - Intronic
951864079 3:27287275-27287297 ATTTCTTTTACCTGAAGTTCAGG - Intronic
952478607 3:33736537-33736559 ATCACTTCCACCTGAAACTTTGG + Intergenic
952521747 3:34167236-34167258 AATGCTTTCACCTTAACATCAGG - Intergenic
953503984 3:43464917-43464939 ATTGCTTTTTCCTTAAAATCAGG + Intronic
953628653 3:44592482-44592504 ACTGGTTTGACGTGAAACTCTGG - Intronic
956998008 3:74850411-74850433 ATTTTATTCACCTGAAACTGAGG + Intergenic
958134410 3:89469340-89469362 ATTTTTTTTTCCTGAAACTCAGG + Intronic
958270901 3:91498070-91498092 ATTGCTTTCATCTTAATCACTGG + Intergenic
958983743 3:100756166-100756188 ATTGCTCTCAGCTGAAAATTAGG - Intronic
960384307 3:117002684-117002706 ATTGCTTTCACTTGAAGCTTAGG - Intronic
960801310 3:121543209-121543231 ATTGCTTGAAACTGAAACTTGGG - Intronic
961501361 3:127338208-127338230 ATGGCTCTCACCTGAGACTCCGG + Intergenic
962948673 3:140198040-140198062 ATTGCTTTTGCTTGAAACACTGG - Intronic
963301145 3:143598426-143598448 CCTGCTTTCACTTGAAGCTCAGG + Intronic
963970459 3:151423801-151423823 TTTCCTTTCATCTTAAACTCAGG + Intronic
967094511 3:186165775-186165797 ACTGCTTTCACAAGAAACTGGGG - Intronic
967247284 3:187500924-187500946 AGTGCATTCACCTAACACTCAGG + Intergenic
967869330 3:194217125-194217147 ATTCCTATCCCCTGAAAGTCTGG - Intergenic
968396048 4:239509-239531 AGTCCTTTCACCTGAGACACAGG + Intergenic
968415033 4:424373-424395 AGTCCTTTCACCTGAGACACAGG + Intergenic
971852933 4:32007366-32007388 ATTGCTTTTAGCTGAAATACAGG - Intergenic
974976988 4:68904337-68904359 ATTACTTTCAGCCCAAACTCTGG + Intergenic
975378852 4:73675369-73675391 ATTTCTATCTCCTGAAACTAGGG - Intergenic
983346939 4:166538832-166538854 ATGGCTTTCCCCTGAAGATCAGG + Intergenic
986022253 5:3815210-3815232 AGTGCTTTCACCTGTAGCTGTGG - Intergenic
987166557 5:15204126-15204148 ATTGCTTTCACCTGAAGTCATGG - Intergenic
988536021 5:32069547-32069569 TTTGCTTTCTGCTGAAAATCAGG + Exonic
988835638 5:35029783-35029805 ATGGATTACACTTGAAACTCAGG + Intronic
988900421 5:35726369-35726391 TTTCCTTTGACCTGAATCTCTGG - Intronic
988966407 5:36422733-36422755 ATTGCTTACAACTGAAAAGCTGG + Intergenic
989954189 5:50337178-50337200 ACTGCTTACACCTAAAACTTGGG + Intergenic
990523802 5:56605480-56605502 ATTTCTCTCAACTGAAACACAGG - Intronic
990682460 5:58260624-58260646 CTTGCTTTCACCTAAATTTCGGG + Intergenic
992888884 5:81185674-81185696 ATTGCTTTCCCCTGGACCTGAGG + Intronic
993336508 5:86666150-86666172 ATTGCTTCCACCTGGAAGTGAGG - Intergenic
993359802 5:86960515-86960537 ATTGGTTTCTCCTGGAACTGTGG - Intergenic
995246890 5:109945069-109945091 ATGCCTTTCACCCAAAACTCAGG + Intergenic
995474759 5:112536615-112536637 ATTGCTTTCATTTAAAAATCAGG - Intergenic
996206680 5:120746553-120746575 ATTTCTTTCACATGAAACACTGG + Intergenic
997426130 5:133803915-133803937 ATAGCTTCCACCTGAAAATCAGG - Intergenic
999227510 5:150038672-150038694 ATTGCTTTCACATGACATTCTGG - Intronic
1000206288 5:159062527-159062549 ATAGCATTGACCTGATACTCTGG - Intronic
1000279755 5:159772502-159772524 GTTTCTTTCACCTGAAAATTGGG + Intergenic
1001532469 5:172473316-172473338 TTTGCTTTCAACTTAAACTGTGG - Intergenic
1005832448 6:29681413-29681435 ATTGCTCACACCTGTAATTCCGG + Intergenic
1008835295 6:55820205-55820227 AGTCATTTCACCTGGAACTCTGG - Intronic
1008893764 6:56527537-56527559 ATTACTTTCATATGAAACTCAGG - Exonic
1008984242 6:57523262-57523284 ATTGCTTTCATCTTAATCACTGG - Intronic
1009172296 6:60416140-60416162 ATTGCTTTCATCTTAATCACTGG - Intergenic
1009435416 6:63612753-63612775 TTTGTTTACAACTGAAACTCTGG + Intergenic
1010375173 6:75160356-75160378 ATTGCTTTCACCTGAAACTCAGG - Intronic
1012683459 6:102212112-102212134 ATTCCTTACACCTGAATCTGAGG - Intergenic
1013605741 6:111745913-111745935 ATTGATTTCCCATGTAACTCTGG + Intronic
1013713675 6:112932032-112932054 ATTGCATTGACCTCAGACTCAGG + Intergenic
1014808600 6:125859843-125859865 ATTGCTATCTCCTGACACTTAGG + Intronic
1019569406 7:1703757-1703779 TTTGCTTTGGACTGAAACTCAGG - Intronic
1022225131 7:28354937-28354959 AATGCTGTCATCTGAAACCCAGG - Intronic
1024146526 7:46522807-46522829 ATTGCTTTCACCTTATTCTGTGG + Intergenic
1026288238 7:68982908-68982930 ATTTCTTTCAACTGTAACTGTGG - Intergenic
1026406604 7:70072509-70072531 ATTACTTTCAGCTGAACCTCGGG - Intronic
1029143794 7:98431195-98431217 ATTGCTGTCACCTGGAACCTGGG + Intergenic
1032430569 7:131857927-131857949 ATTGCTTTCTCCAGATACTGGGG - Intergenic
1033246084 7:139717354-139717376 GTTGCTTTCTACTGAAACTCAGG + Intronic
1033676597 7:143546217-143546239 ACTGCTTTCACCAGAAAATGTGG - Intergenic
1033695236 7:143783221-143783243 ACTGCTTTCACCAGAAAATGTGG + Intergenic
1035912852 8:3587097-3587119 ATTGCTTTCTTCTAAAACACAGG - Intronic
1036477759 8:9109232-9109254 ATTGCAGTATCCTGAAACTCAGG + Intronic
1036555681 8:9857511-9857533 ATTGCTTTTATCCGAAAGTCAGG - Intergenic
1038869981 8:31483365-31483387 AGTGCCTTCACCTGAAAATTAGG - Intergenic
1039142436 8:34405215-34405237 ATTGTTTACACTTGAAACTCAGG + Intergenic
1040020626 8:42737614-42737636 ATTGCTTTAAGCTAAAATTCAGG - Intergenic
1044933283 8:97270556-97270578 TTCACTTTCACCTGAAACTCTGG - Intergenic
1045130044 8:99140737-99140759 TTTGTTTACAACTGAAACTCTGG + Intronic
1047127680 8:121980545-121980567 AATGCTTTCCCCTGGAAGTCAGG - Intergenic
1047543464 8:125793071-125793093 ATTGTATCCACTTGAAACTCTGG + Intergenic
1050593657 9:7184711-7184733 ATTAAATTCATCTGAAACTCAGG - Intergenic
1053336964 9:37283315-37283337 TTTGTTTTCTCCTGAAACTATGG - Intronic
1054722153 9:68614982-68615004 CTTGCTTTCGCCTCAGACTCTGG + Intergenic
1055562872 9:77538421-77538443 TTTGCTTCCACATGAAACTTGGG + Intronic
1055629806 9:78212120-78212142 ATTTCTCCCACCTGAAAGTCTGG - Intergenic
1058265989 9:102899306-102899328 TTTGGTTTCACATGAAATTCTGG - Intergenic
1062182331 9:135197073-135197095 ATCGCCTTCCCCTGAAACGCTGG - Intergenic
1187002350 X:15195612-15195634 ATTCCTTTCACCTGGAAAACAGG + Intergenic
1188645252 X:32558626-32558648 TTTGCTTTTATGTGAAACTCTGG - Intronic
1190943054 X:55062267-55062289 ATGGCTTTTACCTGAAAGTCAGG - Intergenic
1194692382 X:97003473-97003495 ATGGCTTTCATCTGAAAGACAGG - Intronic
1196278973 X:113800489-113800511 ATTGCCTTCACCCAAAATTCTGG + Intergenic
1197525619 X:127558849-127558871 ATTTCTTACATCTGAAAATCTGG - Intergenic
1200962714 Y:9009954-9009976 ATTACTTCCACCTGAAAAACAGG - Intergenic