ID: 1010375774

View in Genome Browser
Species Human (GRCh38)
Location 6:75168470-75168492
Sequence CATCTGAGCAGGTCAACAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010375771_1010375774 -10 Left 1010375771 6:75168457-75168479 CCAGGTATGCAACCATCTGAGCA 0: 1
1: 0
2: 0
3: 7
4: 96
Right 1010375774 6:75168470-75168492 CATCTGAGCAGGTCAACAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010375774 Original CRISPR CATCTGAGCAGGTCAACAAC AGG Intronic
No off target data available for this crispr