ID: 1010375954

View in Genome Browser
Species Human (GRCh38)
Location 6:75170543-75170565
Sequence AAGCCGACTTTGAAGTTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 122}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010375954 Original CRISPR AAGCCGACTTTGAAGTTGAA TGG (reversed) Intronic
909404227 1:75268463-75268485 AAGCCTACGTTTAAGTTAAAGGG - Intronic
909591540 1:77354398-77354420 AAGCCAACTCTGAATTTAAAGGG + Intronic
913171565 1:116237363-116237385 TAGCCGGCTTTGAAGATGGAGGG - Intergenic
913962006 1:143347107-143347129 AAGCCAACTTTGCACTTGATGGG + Intergenic
914056361 1:144172682-144172704 AAGCCAACTTTGCACTTGATGGG + Intergenic
914122785 1:144793680-144793702 AAGCCAACTTTGCACTTGATGGG - Intergenic
917320023 1:173771127-173771149 AAACTGACTTTGAAGTACAAAGG + Intronic
917836681 1:178946720-178946742 ATGCCGTCTTTGAAGTTAGAGGG - Intergenic
917883586 1:179362881-179362903 AGGCCTACGTTAAAGTTGAACGG - Intergenic
924219635 1:241860209-241860231 AAAAGGACTTTGAAGATGAATGG + Intronic
1064719257 10:18212130-18212152 AGGCCGACCTTGGAGTGGAATGG + Intronic
1064913401 10:20427915-20427937 AGGCAGACTTTGAGATTGAATGG - Intergenic
1066071969 10:31826056-31826078 AAGCCCACTTTTCAGTTGAATGG + Intronic
1067950792 10:50736861-50736883 AAGCCAACTATCAAGCTGAAAGG + Intergenic
1068272273 10:54743955-54743977 AAGCCAACTATCAAGCTGAAAGG - Intronic
1070886138 10:79902070-79902092 AAGCCAACTATCAAGCTGAAAGG + Intergenic
1072598137 10:96895136-96895158 TAGGTGACTTTGAAGTTAAAAGG - Intronic
1074781526 10:116805776-116805798 AAGCCTACACTGTAGTTGAAGGG - Intergenic
1075517574 10:123120776-123120798 GAGCCCAGTTTGAAGTTGCAGGG + Intergenic
1078801485 11:14649202-14649224 AAGCTGACTTGGTAATTGAAAGG - Intronic
1079410737 11:20185025-20185047 AGGCCTACTTTGAAGTTCAGGGG + Intergenic
1080174583 11:29346795-29346817 GAGACGACTTTGGAGTTGATAGG + Intergenic
1080418894 11:32092931-32092953 GAGGTGACTTTGAAGTTCAAAGG - Intronic
1080690184 11:34549826-34549848 AAGCGGAATTTGATTTTGAAAGG + Intergenic
1083524780 11:63352807-63352829 AAGCACACTTTGAAATTTAAGGG - Intronic
1084437378 11:69151937-69151959 AAGCCGACAGGGAATTTGAAGGG - Intergenic
1086458015 11:86978379-86978401 AAACCCACTTTAAAGTTGAAGGG + Intergenic
1087639425 11:100740621-100740643 AAGCAGAGTTTGATGTAGAATGG + Intronic
1089838336 11:121391702-121391724 TTGCCGACTTTGAAGATGGAAGG - Intergenic
1095201207 12:39386547-39386569 ACACTGACTTGGAAGTTGAACGG + Intronic
1096814123 12:54191023-54191045 AAGCAGACTTTGAATGTGGAGGG - Intergenic
1103206631 12:119134685-119134707 AAGCTGGCTTTGATGCTGAAGGG - Intronic
1104042186 12:125137869-125137891 AAGCTGACTTTGATGTTGCCCGG + Intronic
1107092475 13:36496752-36496774 AAGCAGACTTTGAAGATGAGAGG + Intergenic
1109984656 13:69963785-69963807 AAGCCGACTTCAAAAATGAATGG - Intronic
1111226211 13:85274390-85274412 TAACAGACTTTGAAGGTGAAAGG - Intergenic
1111870675 13:93827831-93827853 ATGCCCACTTTGAAAGTGAATGG - Intronic
1114135715 14:19847348-19847370 AAGCCGAGTCTGCAGATGAATGG + Intergenic
1123795862 15:23769316-23769338 AAGCTGAGTCTGATGTTGAAGGG + Intergenic
1125040918 15:35186381-35186403 AAACCTACTGTGAACTTGAAGGG + Intergenic
1129425794 15:75461832-75461854 AATCGGACTTTGCATTTGAATGG - Intergenic
1130441547 15:83959608-83959630 AAACTGACTTTCAAGTTTAAAGG + Intronic
1131204348 15:90428803-90428825 AAGCAGACATTGAAGTTTAGAGG + Intronic
1132084659 15:98897870-98897892 AAAATGGCTTTGAAGTTGAAAGG + Intronic
1133217081 16:4299130-4299152 ATGCCAACTTTGAAGGTCAAAGG - Intergenic
1134840898 16:17400724-17400746 AAGCTGACTTTGAAGGTTGATGG - Intronic
1137230042 16:46556260-46556282 AAACCTACTTTGTTGTTGAATGG + Intergenic
1141535564 16:84677494-84677516 AAGCAGAGCTTCAAGTTGAATGG - Intergenic
1141807982 16:86354535-86354557 AGGCAGACTTTGTGGTTGAAAGG + Intergenic
1145783019 17:27576098-27576120 AAGCAGACTTTGAAGGAGGAGGG - Intronic
1148259836 17:46171845-46171867 AAGGAGTCTTTGAAGTTGCAAGG - Exonic
1150577287 17:66441447-66441469 AAGCAGACTTTGAAGTGAAAGGG - Intronic
1151389565 17:73776853-73776875 AAGCCGCCTGGGAAGTTGAGAGG - Intergenic
1151915736 17:77116700-77116722 AAGCCAATTTGGAATTTGAAGGG + Intronic
1157256644 18:46145471-46145493 AAGCTGTATTTGAAGATGAAAGG + Intergenic
1159566581 18:70057896-70057918 AATCAGAATTTGAAGTTTAAAGG + Intronic
1164758796 19:30711300-30711322 AAGACGACTTTCGAGTTGGAAGG - Intronic
1164819425 19:31234823-31234845 AAGCCGACAATGCAGTTGGAAGG - Intergenic
1165175985 19:33930237-33930259 AAGCCAACTGTGAAGATGAGAGG + Intergenic
1167736998 19:51300852-51300874 AAACCCACCTCGAAGTTGAAGGG + Intergenic
1202695843 1_KI270712v1_random:125359-125381 AAGCCAACTTTGCACTTGATGGG + Intergenic
931670000 2:64638598-64638620 AAGCCGATTCTGATGTTGATAGG - Intronic
931755762 2:65372611-65372633 AAGTGGAATTTGAAGTTCAAGGG + Intronic
934277008 2:91582406-91582428 AAGCCAACTTTGCACTTGATGGG + Intergenic
938681798 2:133699719-133699741 TTGCTGACTTTGAAGTTGGAAGG - Intergenic
942082998 2:172419007-172419029 AAGGCTTCTTTGAAGTTGAAAGG - Intergenic
942562041 2:177230002-177230024 AGGCAGAGTTTGAAGTAGAAAGG - Intronic
943535303 2:189141176-189141198 AAGCCGACTTGGAAGTTAGCTGG + Intronic
944944686 2:204670000-204670022 AAGATGATTCTGAAGTTGAACGG + Intronic
945586025 2:211664061-211664083 AAGGTGAATTTGAATTTGAATGG + Intronic
946590179 2:221237823-221237845 AAGCAGAAATTGAAGTTGCATGG - Intergenic
947066656 2:226234434-226234456 GAGACAAATTTGAAGTTGAAAGG - Intergenic
1174182010 20:48680850-48680872 GAGCCGACCTTGTAGTTGGAGGG - Intronic
1175240997 20:57548776-57548798 AAGCCGATTGTGAAGTTCAGAGG + Intergenic
1176814308 21:13582001-13582023 AAGCCGAGTCTGCAGATGAATGG - Intergenic
1183175566 22:36222569-36222591 AGGCTGGCTTTGAAGATGAAGGG - Intergenic
1183781374 22:40001204-40001226 AGACAGACTCTGAAGTTGAAAGG + Intronic
950416260 3:12870488-12870510 AATCAGTCTTTCAAGTTGAAGGG - Intronic
951165206 3:19477470-19477492 AAGGGGACCCTGAAGTTGAAGGG + Intronic
953638579 3:44684789-44684811 AAGACGACTTTGAAGAGTAAGGG - Intergenic
956520835 3:70102473-70102495 AATCCCACTTCGTAGTTGAATGG + Intergenic
968705832 4:2076982-2077004 TAGCCTCCTTGGAAGTTGAAGGG - Intronic
969101202 4:4769472-4769494 AAGCCGGCTTTGGAGTGGATGGG + Intergenic
969328242 4:6456540-6456562 ACGCCGACTTTCAATGTGAAAGG - Intronic
971893100 4:32551432-32551454 CAACAGATTTTGAAGTTGAAAGG - Intergenic
973841847 4:54870209-54870231 AAACAGACTTTGAAGTTGGAAGG - Intergenic
974413558 4:61574109-61574131 AAGCCGACTTTCATGGTGACTGG - Intronic
976971764 4:91112056-91112078 AAGCTGACTTTAAGGTTTAAAGG - Intronic
977374342 4:96182133-96182155 TAGCTGACTTTGAAGATGGAGGG + Intergenic
980618131 4:135260788-135260810 AATCCTACTTTGATATTGAAAGG + Intergenic
989119739 5:37992328-37992350 AAACTGATCTTGAAGTTGAAAGG + Intergenic
989239428 5:39187139-39187161 AAGCTTGCTTTGAAGTTGATAGG - Intronic
990368754 5:55095605-55095627 AAGCTGAGTTTGAAATTGCAGGG - Intergenic
993097274 5:83494081-83494103 AAGCCGAAATTAAAGTGGAAAGG + Intronic
997394828 5:133550854-133550876 AAGCCAACTTTTAGGTAGAATGG + Intronic
1000005604 5:157181044-157181066 AAGCGGACTTTAAAGTTCGAGGG - Exonic
1001696941 5:173677436-173677458 AAGACGACTCAGAAGTTCAATGG + Intergenic
1006572797 6:35019223-35019245 AAGCTGCCTTTGAAGTGGACTGG + Intronic
1007002837 6:38330594-38330616 AAGCCGATTTTCAAGTTCATTGG + Intronic
1010375954 6:75170543-75170565 AAGCCGACTTTGAAGTTGAATGG - Intronic
1010821915 6:80424296-80424318 AAGCGTGCTTTGAAGTTTAAAGG - Intergenic
1011439655 6:87374071-87374093 AAGCCGACTGTGAAGGGGCATGG + Intronic
1018607686 6:165615343-165615365 AAACCGACATTGAAATTGATAGG - Intronic
1021546033 7:21813805-21813827 AAGCAGACTTTGAACTTAAAGGG + Intronic
1021984103 7:26082255-26082277 AGGCTGACTCTGAGGTTGAAGGG + Intergenic
1033285405 7:140037001-140037023 TAGGCGACTTTGGAGTTGATGGG - Intronic
1033761441 7:144440667-144440689 AATCAGACTGTGAAGTTTAAAGG + Intergenic
1033864131 7:145667558-145667580 AAACTAACTTTGAAGTTGATAGG + Intergenic
1036957506 8:13204410-13204432 AAGCGGACTTTAAAGTCTAAGGG - Intronic
1038531726 8:28323565-28323587 ATCCCCACTTTGTAGTTGAAAGG + Intronic
1039188170 8:34940842-34940864 AAGCTGACTTTGAAGTTTGTTGG - Intergenic
1039956195 8:42208779-42208801 GTGCTGAGTTTGAAGTTGAAAGG + Intergenic
1041846572 8:62335928-62335950 AAGCCTTCTTTCTAGTTGAAAGG + Intronic
1044484940 8:92741272-92741294 AAGTGGACTTTGAATCTGAAAGG - Intergenic
1046259755 8:111752059-111752081 ATGCTGACTTTGAAGATGGAGGG - Intergenic
1046442502 8:114276970-114276992 AAGACTACTTCGAAGATGAAGGG - Intergenic
1048605569 8:135964817-135964839 AAGCAGCCTTCAAAGTTGAATGG + Intergenic
1050561957 9:6843260-6843282 CAGCCCTCTTTGAAGTGGAATGG + Intronic
1051880470 9:21834719-21834741 AAGCTGACTTTAAAATAGAAAGG - Intronic
1055957863 9:81791363-81791385 CAGCTGGCTTTGAAGATGAAGGG + Intergenic
1056790222 9:89620405-89620427 GAACCGACATTGAACTTGAACGG + Intergenic
1059513107 9:114867883-114867905 CAGCCATCTTTGAAGTAGAAAGG - Intergenic
1061860278 9:133464396-133464418 TGGCCGAGTTTGAAGTGGAAGGG + Intronic
1189395345 X:40617642-40617664 TAGCCGGCTTTGAAGATGGATGG - Intergenic
1189660577 X:43292785-43292807 AAGCTGACTTTCAAGTATAAAGG - Intergenic
1190768146 X:53492661-53492683 AAGTTGAATTTGAAGTTGAGAGG + Intergenic
1194140880 X:90207689-90207711 CTGCAGACTTTGAAGATGAAGGG - Intergenic
1196061703 X:111414841-111414863 AAGTCAACTTTGAAGGTCAAGGG - Intergenic
1198126219 X:133646629-133646651 AAGCTGAGCTTGGAGTTGAAAGG + Intronic
1200486644 Y:3776810-3776832 CTGCAGACTTTGAAGATGAAGGG - Intergenic