ID: 1010377008

View in Genome Browser
Species Human (GRCh38)
Location 6:75182363-75182385
Sequence GGGACCTATAGGAAGGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 834
Summary {0: 1, 1: 0, 2: 10, 3: 102, 4: 721}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010377008 Original CRISPR GGGACCTATAGGAAGGTGGG GGG (reversed) Intronic
900488453 1:2934684-2934706 GGGACCCACAGGAAGCTGTGAGG + Intergenic
900491919 1:2954104-2954126 GGGACCCACAGGAAGCTGTGAGG + Intergenic
900499383 1:2993355-2993377 GGGGCCTATGGGAGGGTGGAGGG + Intergenic
900690171 1:3976020-3976042 GGGACCTAGTGGAAGGTGATTGG + Intergenic
900921369 1:5673156-5673178 GGGACCTAGAGGGAGGTGATTGG + Intergenic
903187948 1:21639949-21639971 GGGCCTTCTAGGCAGGTGGGTGG - Intronic
903289784 1:22302350-22302372 GGGGCCTATTGGAGGGTGGATGG + Intergenic
904045777 1:27607405-27607427 GTGGCCTAGAGGAATGTGGGAGG - Intergenic
904801950 1:33099280-33099302 GGTACCTGGAGGAAGGAGGGAGG - Intronic
904958175 1:34306359-34306381 GCCACCTATGGGAAGGTGGGGGG - Intergenic
905706178 1:40060628-40060650 GAGGCATAAAGGAAGGTGGGAGG - Intronic
905815854 1:40950247-40950269 AGGACCTGTCGGAGGGTGGGAGG + Intergenic
906045668 1:42829088-42829110 GTAACCTATAGGAAAGTGGGTGG + Intronic
906806099 1:48780187-48780209 GGGGCCTGTAGGGGGGTGGGGGG - Intronic
907027723 1:51138040-51138062 GGGGCCTATAAGAAGGTGGAGGG + Intronic
907638756 1:56163658-56163680 GGGACCTACTGGAAGGTAGAGGG - Intergenic
908407144 1:63826247-63826269 AGGGCATATAGGAAGGTGGAGGG - Intronic
908586730 1:65577961-65577983 GGGGCCTGTAGGGGGGTGGGAGG - Intronic
908603598 1:65768254-65768276 GGGGCCTATGGGAGGGTGGAAGG - Intergenic
909288628 1:73853987-73854009 GGAACCTGAAGGAAGCTGGGAGG - Intergenic
909523756 1:76599450-76599472 GGGGCCTGTCGGAGGGTGGGGGG - Intronic
909582785 1:77256816-77256838 GGGGCCTCTCGGAGGGTGGGAGG - Intergenic
909772852 1:79445903-79445925 GGGGCCTCTTGGAGGGTGGGAGG + Intergenic
910096940 1:83533943-83533965 GGGGCCTGTTGGAGGGTGGGAGG - Intergenic
910367878 1:86486147-86486169 GGGACCTGGTGGGAGGTGGGAGG - Intronic
910753053 1:90655140-90655162 GGGGCCTACTGGAAGGTGGAGGG + Intergenic
911210614 1:95134569-95134591 GGGACCTAGAGGAAGGTTGTGGG + Intronic
911243741 1:95493854-95493876 GGGGCCTATCGGAGGGTGGGAGG + Intergenic
911340210 1:96627120-96627142 GGGACCTATAGGAGGGTAGAGGG + Intergenic
912607219 1:111003530-111003552 GGGACCTGTCGGGAGGTGGAGGG + Intergenic
912854005 1:113151278-113151300 GGGGCCTATTGGAGGGTGGAGGG + Intergenic
913048697 1:115096131-115096153 GGGGCCTATAGGAAGGTGGAAGG - Intergenic
913228394 1:116720594-116720616 TGAACCTAGAGGAAGGTGGCGGG - Intergenic
914200253 1:145478113-145478135 GGGGCCTATAGGGGGGTGGGGGG - Intergenic
914479368 1:148051265-148051287 GGGGCCTATAGGGGGGTGGGGGG - Intergenic
915692837 1:157707304-157707326 GGGGCCTGTTGGAGGGTGGGGGG + Intergenic
915697605 1:157760278-157760300 GGGACCTATTTGAGGGTGGAGGG + Intronic
915885523 1:159717208-159717230 GGGACCTGGTGGGAGGTGGGTGG + Intergenic
915949165 1:160176461-160176483 GGGACCTGGAGGATGGAGGGTGG - Exonic
916013728 1:160729653-160729675 GGGACCTAATGGAAGGTGTTTGG - Intergenic
916616502 1:166446604-166446626 GGGACCTATTTGAGGGTGGAGGG - Intergenic
916762914 1:167833158-167833180 CAGACCTACAGGGAGGTGGGAGG + Exonic
916916639 1:169413858-169413880 GGGGCCTGTCGGAGGGTGGGGGG + Intronic
916978047 1:170103070-170103092 GGGGCCTGTCAGAAGGTGGGGGG - Intergenic
917295664 1:173516466-173516488 GGGGCCTATTGGAGGGTGGAGGG - Intronic
917644187 1:177013807-177013829 GGGTCCTGAAGGAGGGTGGGAGG - Intronic
918503383 1:185223801-185223823 GGGGCCTATTGGAGGGTGGAAGG - Intronic
918752154 1:188286498-188286520 GGGGCCTATCGGAGGGTGGAGGG - Intergenic
918930399 1:190847862-190847884 GGGGCCTATTTGAAGGTGGAGGG + Intergenic
919326316 1:196111249-196111271 GGGACCTGTTGGGGGGTGGGGGG + Intergenic
920429231 1:205905448-205905470 GGGACCTGTCGGGGGGTGGGGGG + Intergenic
920542470 1:206789730-206789752 TGGGCCTATTGGAGGGTGGGAGG - Intergenic
920610916 1:207437139-207437161 TGGACCTATTGGAGGGTGGAGGG + Intergenic
920981392 1:210839415-210839437 GGGGCCTGTTGGAAGGTGAGGGG + Intronic
922342962 1:224672205-224672227 GGGACTTACAGGAAGGTTTGGGG + Intronic
923347649 1:233071318-233071340 GGGACCTATCAGAGGGTGGAGGG - Intronic
924045282 1:240023079-240023101 GGGACCTATCGGAGGGTGGAGGG + Intronic
924421197 1:243911696-243911718 GGGGCCTGTAGGGAGGTCGGGGG + Intergenic
924891748 1:248290105-248290127 GGGACCTTTTGGGGGGTGGGGGG - Intergenic
924945406 1:248843065-248843087 GGGGCCTTTAGGAAGGGGCGGGG + Intronic
1063076806 10:2724950-2724972 GGGGCCTATTGGGAGGTGGGCGG - Intergenic
1063699203 10:8368380-8368402 AGGGCCTATTGGAAGGTGGAAGG + Intergenic
1063710220 10:8470039-8470061 GGGGCCTATCGGAGGGTGGAGGG + Intergenic
1064235251 10:13567917-13567939 GGGGCCTGTCGGAGGGTGGGGGG + Intergenic
1064576238 10:16748765-16748787 GAGACTTAAAGGAAGGAGGGAGG - Intronic
1064647414 10:17473712-17473734 GGGACCTAGTGGAAGGTGATTGG + Intergenic
1065189017 10:23193645-23193667 GGGACCAATGGGAATGTGGTTGG + Intronic
1065598713 10:27346264-27346286 GGGGCCTATCGGAGGGTGGAAGG - Intergenic
1065791552 10:29265020-29265042 GGGGCCTATTGGAAGGTGGAGGG + Intergenic
1065801286 10:29355448-29355470 AGCTCCTATAGGGAGGTGGGGGG - Intergenic
1066506270 10:36048019-36048041 GGGGCCTATTGGAAGGTGGAGGG + Intergenic
1066585939 10:36935576-36935598 GGGGCCAATAGGATGGTGGAGGG - Intergenic
1067013883 10:42740928-42740950 GAGACTTAAAGGAAGGAGGGAGG + Intergenic
1067825241 10:49567327-49567349 GGGATCTATTAGAAGGTGGAGGG + Intergenic
1068073096 10:52220570-52220592 GGGGCCTATTGGAGGGTGGAGGG - Intronic
1068322990 10:55444123-55444145 GGGGCCTATCGGGGGGTGGGGGG + Intronic
1068795040 10:61070059-61070081 GGGGCCTAATGGAAGGTGTGTGG - Intergenic
1068810635 10:61251966-61251988 GGAGCCTATTGGAAGGTGGGGGG - Intergenic
1069333602 10:67322379-67322401 TGGGCCTATTGAAAGGTGGGTGG - Intronic
1069358729 10:67617254-67617276 GGGTCCTATAAGAGGGTGGAGGG - Intronic
1070062300 10:72995860-72995882 GGGGCCTATCGGGGGGTGGGGGG + Intergenic
1070065231 10:73027437-73027459 GGGGCCTGTCGGAGGGTGGGGGG + Intronic
1070118083 10:73548718-73548740 GGGGCCTGTCGGGAGGTGGGGGG + Intronic
1070846808 10:79529604-79529626 GGGGCCTATGGGAAGATGGAGGG - Intergenic
1070850581 10:79559192-79559214 GGGGGCTATAGTAAGCTGGGTGG - Intronic
1070856637 10:79612095-79612117 GGGGGCTATAGTAAGCTGGGTGG + Intronic
1070926991 10:80230663-80230685 GGGGCCTATGGGAAGATGGAGGG + Intergenic
1071063267 10:81599522-81599544 GGGGCCTATTGGAGGGTGGAGGG + Intergenic
1071151464 10:82639923-82639945 GGGGCCTATTGGAGGGTGGAGGG - Intronic
1071184296 10:83023079-83023101 GGGGCCTGTTGGAGGGTGGGGGG + Intergenic
1071881702 10:89905946-89905968 GGGACCTATCAGAGGGTGGAGGG - Intergenic
1072091204 10:92129334-92129356 GGGGCCTATCGGAGGGTGGAGGG + Intronic
1072295901 10:94009363-94009385 GGGACCTAGTGGAAGGTGTTTGG - Intronic
1072847061 10:98843197-98843219 GGGGCCTATCGGAGGGTGGAGGG - Intronic
1072901139 10:99407963-99407985 GGGGCCTATCGGTGGGTGGGAGG - Intronic
1073714697 10:106091013-106091035 GGCACCTGTGGGGAGGTGGGGGG - Intergenic
1073962911 10:108954524-108954546 GGGGCCTATTGGGGGGTGGGGGG + Intergenic
1074627407 10:115206838-115206860 GGGACCTGTCGGCAGGTGAGGGG - Intronic
1074807144 10:117065145-117065167 GGGGCCTGTAGGGAGGTTGGGGG + Intronic
1075015335 10:118906600-118906622 GGGGCCTATCGGAGGGTGGAGGG + Intergenic
1075500520 10:122969651-122969673 GGGTCCTATCAGAAGGTGGAAGG + Intronic
1075528975 10:123210981-123211003 GGGGCCTATCAGAGGGTGGGGGG - Intergenic
1076052851 10:127349156-127349178 TGGACCTAAAGGAAGCTGGAGGG - Intronic
1076397495 10:130151523-130151545 GGGGCCTGTTGGAGGGTGGGGGG - Intronic
1077274628 11:1698298-1698320 GGGGCCTATCGGAGGGTGGACGG - Intergenic
1077301610 11:1849830-1849852 GGGACCGGGAGGAAGGTGGATGG + Intergenic
1078027744 11:7714199-7714221 GGGGCCTATTGGAGGGTGGAGGG - Intergenic
1078755809 11:14208192-14208214 GGGGCCTATTGGAAGGTGAAAGG + Intronic
1078815471 11:14817275-14817297 GGGGCCTATAGTGGGGTGGGGGG + Intronic
1079102282 11:17549209-17549231 GGGACCTAGCTGCAGGTGGGTGG - Intronic
1079667760 11:23129019-23129041 GGGACCTATAGGAGGGTGAAGGG - Intergenic
1079778228 11:24561661-24561683 GGGGCCTATCGGAGGGTGGCGGG + Intronic
1080387277 11:31817628-31817650 GGGAGGGATAGGAAGGGGGGTGG - Intronic
1080725051 11:34889637-34889659 GGGACCTACTGGAGGGTGGAGGG - Intronic
1080844284 11:36013459-36013481 GGGGCCTGTAGGGGGGTGGGGGG - Intronic
1081282000 11:41221142-41221164 GGGTCCTTTCGGAAGGTGGAGGG - Intronic
1081316196 11:41633653-41633675 GGGGCCTATTGGAAGGTGGAGGG - Intergenic
1082216262 11:49573539-49573561 GGGGCCTACTGGAGGGTGGGAGG - Intergenic
1084726003 11:70942495-70942517 GGGACCTAGTGGAAGGTGTTTGG - Intronic
1084989019 11:72905590-72905612 GGGACCTGTCGGGGGGTGGGGGG - Intronic
1085314864 11:75538640-75538662 GGATCCTCTAGGGAGGTGGGAGG + Intergenic
1085327664 11:75619509-75619531 GGGGCCTATCAGAAGGTGGAAGG - Intronic
1085410435 11:76287560-76287582 GGGAACTCTAAGAAGGTGAGGGG - Intergenic
1086265507 11:84993251-84993273 GGGGCCTGTCGGAGGGTGGGGGG + Intronic
1087207429 11:95411789-95411811 GGGGCCTATCGGGGGGTGGGGGG + Intergenic
1087306307 11:96492943-96492965 GGGGCGTGTAGGGAGGTGGGTGG + Intronic
1087414095 11:97830618-97830640 GGGACCTATTGGAGGGTCGAGGG + Intergenic
1087620270 11:100533099-100533121 GGGGCCTATTGGAGGGTGGAGGG + Intergenic
1087848846 11:103004938-103004960 GGGACCTATTGGAGGGTGGAGGG + Intergenic
1088362656 11:109007305-109007327 GGGGCCTATTGGAGAGTGGGGGG + Intergenic
1088533781 11:110838241-110838263 GGGGCCTGTTGGGAGGTGGGGGG - Intergenic
1088661044 11:112046618-112046640 AGGACCTGTAGGGGGGTGGGGGG - Intronic
1089044925 11:115492322-115492344 GGCAACTATAGGAAGTTGGGTGG + Intronic
1089112921 11:116071379-116071401 GAGTCATATAGGAAGATGGGTGG + Intergenic
1089418137 11:118310279-118310301 GGGACCTCTCAGAAGGTGGAGGG - Intronic
1090083912 11:123634098-123634120 GTGACCTACAGGAACATGGGAGG - Intronic
1090527897 11:127557053-127557075 GGGGCCTGTAGCAGGGTGGGGGG + Intergenic
1090741390 11:129664430-129664452 GGGGCCTATTGGAGGGTGGAGGG + Intergenic
1091219224 11:133920462-133920484 GGCACCTGCAGGGAGGTGGGGGG + Exonic
1093018640 12:14181940-14181962 GTGGCCTATCGGAGGGTGGGGGG + Intergenic
1093167169 12:15817492-15817514 AGGACCTATAGGAGGGTGGAGGG + Intronic
1094156194 12:27339113-27339135 GAGGCCTATTGGAAGGTGGAAGG - Intronic
1094250432 12:28353883-28353905 GGGGCCAATTGGAAGGTGGAGGG + Intronic
1095302951 12:40608588-40608610 GGGACCTGTTGGAGGGTGGGGGG - Intergenic
1095398960 12:41792606-41792628 GGGGCCTATCGGAGGGTGGTGGG - Intergenic
1095590198 12:43894553-43894575 GGGGCCTATTGGAGGGTGGAGGG - Intronic
1095647766 12:44569035-44569057 GGGGCCTATTGGAAGGTGGAAGG - Intronic
1095705870 12:45236383-45236405 AGGGCCTATTAGAAGGTGGGGGG - Intronic
1096690912 12:53321299-53321321 GGGACCTACAGGCATGGGGGCGG - Intronic
1096784366 12:54008775-54008797 GGGACCTGGAGGAAGGGGAGGGG - Intronic
1096981878 12:55732789-55732811 GAGACATAGAGGAGGGTGGGAGG + Intergenic
1097493514 12:60298958-60298980 GGGGCCTATTGGAGGGTGGAGGG - Intergenic
1098531986 12:71552073-71552095 GGGGCCTGTCGGCAGGTGGGGGG + Intronic
1098927292 12:76364489-76364511 GGGACCTGTCGGTGGGTGGGAGG + Intronic
1098928166 12:76376927-76376949 GAGACCTATTGGGAGGTGGGGGG - Intronic
1099428967 12:82557950-82557972 GGGGCCTGTTGGAAGGTGAGGGG - Intergenic
1099470064 12:83037036-83037058 GGGGCCTATAGGAAGGTGTCTGG - Intronic
1099544220 12:83956126-83956148 GGGACCCAGTGGAAGGTGGTAGG - Intergenic
1099593066 12:84621150-84621172 GGGGCCTGTTGGAAGGTGGGAGG + Intergenic
1100114746 12:91290881-91290903 GGGGCCTATTTGAAGGTGGAGGG - Intergenic
1100115364 12:91296974-91296996 GGGATCTGTCGGAGGGTGGGTGG - Intergenic
1100165717 12:91915317-91915339 TGGAGCAACAGGAAGGTGGGTGG + Intergenic
1100179873 12:92073658-92073680 GGGACCTACTTGAGGGTGGGGGG - Intronic
1100775617 12:97970331-97970353 GGGGCCTATCGGAGGGTGGAAGG - Intergenic
1100916094 12:99423826-99423848 GGGACCTATTGGAGGGTGGAGGG + Intronic
1101082008 12:101196164-101196186 GGGGCCTATTGGAGGGTGGAAGG - Intronic
1101264816 12:103073165-103073187 GGGACCTATTGGAGGATGGAGGG + Intergenic
1101396860 12:104356209-104356231 GGAAACTATAGGAAGATGGGTGG + Intergenic
1101456561 12:104837655-104837677 GGGGCCAAAAGGAAGGTGAGTGG + Intronic
1101542613 12:105678544-105678566 GTGACCACTAGGAAGGAGGGTGG + Intergenic
1101741757 12:107505687-107505709 GGGACCTATTGGAGAGTGGACGG - Intronic
1101827679 12:108233049-108233071 GGGGCATAAAGGAAGGTGGGGGG - Intronic
1101957267 12:109222658-109222680 GGGACACATAGGAGGGTGGGGGG - Intronic
1102409083 12:112701460-112701482 GGTAGCTATGAGAAGGTGGGTGG + Intronic
1102687962 12:114738967-114738989 GGGACAAACAGGAAGATGGGAGG + Intergenic
1102971292 12:117169309-117169331 GGGGCCTATCAGAGGGTGGGCGG + Intronic
1103140971 12:118547958-118547980 GGGACCTGTTGGAAGGTGGGGGG + Intergenic
1103445819 12:120994427-120994449 GGGACACGTGGGAAGGTGGGAGG + Intronic
1103748973 12:123146143-123146165 GGGACTTATTGGAGGGTGGAGGG + Intronic
1104107087 12:125673318-125673340 GGTGCCTATTGGAAGGTGGAGGG + Intergenic
1104129464 12:125879233-125879255 GGGGCCTATTGGAGGGTGGAGGG + Intergenic
1104229282 12:126868569-126868591 GGGTCCTATTGGAGGGTGGAGGG - Intergenic
1104288105 12:127443807-127443829 GGGGCCTATTGAAAGGTGGAGGG - Intergenic
1104429231 12:128703300-128703322 GGGGCCTATTGGAGGGTGGAGGG - Intronic
1105815192 13:24029777-24029799 GGGGCCTATCGGAGGGTGGAGGG - Intronic
1105930555 13:25047973-25047995 GGGACCTACTGGAGGGTGGAGGG - Intergenic
1106244565 13:27937572-27937594 GGGGCCTGTAGGGGGGTGGGGGG + Intergenic
1107262709 13:38514366-38514388 GGGGCCTATTGGAGGGTGGAGGG - Intergenic
1108032062 13:46242303-46242325 GGATCCTATTGGAAGGTGGAGGG + Intronic
1108229833 13:48325132-48325154 GGGACCTATCAGAGGGTGGAGGG - Intronic
1108477448 13:50835032-50835054 GGGGCCTGTAGGGGGGTGGGGGG + Intronic
1108745703 13:53391311-53391333 GGGGCCTGTCGGGAGGTGGGGGG - Intergenic
1109001296 13:56809753-56809775 GGGGCCTGTTGGAGGGTGGGGGG - Intergenic
1110012149 13:70350238-70350260 GGGGCCTATTGGAGGGTGGAGGG - Intergenic
1110277581 13:73657434-73657456 GGGACCTATTGGGAGGTGTTTGG - Intergenic
1110910506 13:80956052-80956074 GGGGACTATGGGAAGGTGGGAGG + Intergenic
1110923505 13:81119979-81120001 GGGGCCTATTGGAGGGTGGGGGG - Intergenic
1111371321 13:87321666-87321688 GGGACCTATCCGGGGGTGGGGGG - Intergenic
1112044355 13:95580896-95580918 GGCCCCTATAGGAAGTTGGAAGG + Exonic
1112157047 13:96829483-96829505 GGGGCCTATCAGAAGTTGGGGGG - Intronic
1112235052 13:97628410-97628432 GGGACTTATCAGAAGGTGGAGGG + Intergenic
1112638773 13:101247805-101247827 GGGGCCTATCAGGAGGTGGGGGG - Intronic
1113247424 13:108413354-108413376 GGGGCCTGTTGGGAGGTGGGGGG - Intergenic
1114694883 14:24617533-24617555 GGGGCCTATTGGGGGGTGGGGGG - Intergenic
1114869571 14:26639971-26639993 GGGGCCTGTTGGGAGGTGGGGGG - Intergenic
1114962362 14:27909345-27909367 GGGGCCTGTTGGTAGGTGGGAGG + Intergenic
1115016047 14:28615694-28615716 GGGGCCTATTGGAGGGTGGAGGG - Intergenic
1115493746 14:33983318-33983340 GGGACCTATCAGGAGGTGGGAGG - Intronic
1115938721 14:38584802-38584824 GGGGCCTATCAGAAGGTGGAGGG - Intergenic
1116112606 14:40606206-40606228 GGGGCCTGTTGGGAGGTGGGGGG - Intergenic
1116360644 14:43992172-43992194 GGGACCTATGGGAAGGTGGAGGG + Intergenic
1116361480 14:44004099-44004121 GGGGCCTATTGGAGGGTGGAGGG + Intergenic
1116765699 14:49067758-49067780 GGGGCCTGTTGGAGGGTGGGGGG + Intergenic
1117000220 14:51364426-51364448 GGGATCTATATGCAGGTGGGAGG + Intergenic
1117123131 14:52590983-52591005 GGGGCCTATAAGGGGGTGGGGGG - Intronic
1117222433 14:53619441-53619463 GGAACATATATAAAGGTGGGGGG + Intergenic
1117342159 14:54801851-54801873 GGGGCCTATCGGAGGGTGGAGGG + Intergenic
1117739448 14:58801560-58801582 GGGGCCTATTGGATGGTGGAGGG - Intergenic
1118054003 14:62059059-62059081 GGGACCTTTGGGAAGGTGGAGGG + Intronic
1118445012 14:65842855-65842877 GGGATCTATAGGCAAGTGGTGGG + Intergenic
1119886727 14:78149789-78149811 GGGATCTAGAGGAAGGATGGGGG - Intergenic
1120352973 14:83386831-83386853 GGGACCTATTGGGAGGTGATTGG - Intergenic
1120878612 14:89397273-89397295 GGGGCCTATTGGAGGGTGGAGGG + Intronic
1121338010 14:93089005-93089027 GGGACCTGTGTGATGGTGGGGGG + Intronic
1122117811 14:99536386-99536408 AGGACCTGTAGAAAGGTGGGGGG + Intronic
1122689154 14:103523288-103523310 GGCACCTTGAGGAAGGTCGGCGG - Intergenic
1122846529 14:104503089-104503111 GGGGCCTAATGGAAGGTGGCTGG + Intronic
1123824125 15:24063803-24063825 GGGGCCTATTGTGAGGTGGGAGG - Intergenic
1124020871 15:25921702-25921724 GGGGCCTTTTGGAGGGTGGGTGG - Intergenic
1124039043 15:26083081-26083103 GGGATCTATGGGAGGGTGGAGGG + Intergenic
1124113116 15:26811489-26811511 GGGACCTACCTGAAGGTGGAGGG + Intronic
1124203326 15:27697046-27697068 GGGACATGAAGGTAGGTGGGAGG - Intergenic
1124501508 15:30231472-30231494 GGGGCCTGTAGGGAAGTGGGGGG - Intergenic
1124742058 15:32307195-32307217 GGGGCCTGTAGGGAAGTGGGGGG + Intergenic
1124812041 15:32950677-32950699 GGGGCCTATTAGAAGGTGGAGGG + Intronic
1125076009 15:35619398-35619420 GGGGCCTATTGGAGGGTGGAGGG - Intergenic
1125367578 15:38934790-38934812 GGGGCCTATTGGATGGTGGTGGG + Intergenic
1125449329 15:39791642-39791664 GGGGCCTATCGGAGGGTGGAGGG + Intergenic
1125793357 15:42386478-42386500 GGGACATAGTGGAAGGTGGTGGG - Intronic
1126424505 15:48512480-48512502 GGGGCCTATTGGAGGGTGGAGGG - Intronic
1126933700 15:53683133-53683155 GGGACCTGTTGGAAGGTGATTGG - Intronic
1127055565 15:55127542-55127564 GGGGCCTATTAGGAGGTGGGGGG + Intergenic
1127571868 15:60251454-60251476 TGGCCCTATAGGCAGATGGGAGG - Intergenic
1127793824 15:62421662-62421684 GGGGCCTATTGGAGGGTAGGGGG + Intronic
1128269440 15:66295182-66295204 GGGACCTTTTCTAAGGTGGGGGG - Intronic
1128342280 15:66830902-66830924 GGGCCCTCTAGGAAGGAGGCGGG - Intergenic
1128801483 15:70499889-70499911 GGAACCTATTTGAGGGTGGGTGG - Intergenic
1128853036 15:70981333-70981355 GGGGCCTGTTGGAGGGTGGGGGG + Intronic
1129008481 15:72395169-72395191 GGGGCCTATCGGAGGGTGGGGGG - Intergenic
1129786414 15:78313121-78313143 GGGACCTGTTGGAGGCTGGGAGG + Intergenic
1130189463 15:81719106-81719128 GGGGCCTACTGGAAGGTGGAGGG - Intergenic
1130386704 15:83418258-83418280 GGAACCTATAGGAAAGCTGGCGG + Intergenic
1130424589 15:83782711-83782733 GGGACATATTGGAGGGTGGAAGG + Intronic
1131038500 15:89241764-89241786 ATGATCTAAAGGAAGGTGGGTGG - Intergenic
1131344970 15:91637897-91637919 GGGGCCTATCGGAGGGTGGAGGG - Intergenic
1131976300 15:97949188-97949210 GGGGCCTATCGGAGGGTGGAGGG - Intergenic
1132113173 15:99117085-99117107 GGGGCCTAGAGGAAGGTGTTTGG - Intronic
1133695763 16:8261047-8261069 GGGGCCTATTGGAGGGTGGAGGG - Intergenic
1133976365 16:10602152-10602174 GGGACCTGAAGGGAGCTGGGGGG - Intergenic
1134741552 16:16551478-16551500 GGGACCTATTGGGAGGTGTTTGG - Intergenic
1134898629 16:17913822-17913844 GGGAAGTATGTGAAGGTGGGAGG + Intergenic
1134926008 16:18160952-18160974 GGGACCTATTGGGAGGTGTTTGG + Intergenic
1135474275 16:22760529-22760551 GGGGCCTATTGGAGGGTGGAAGG + Intergenic
1137343318 16:47631630-47631652 GGGGCCTGTCGGAGGGTGGGAGG - Intronic
1137456681 16:48623125-48623147 GGGTCCTATCGGTGGGTGGGGGG - Intergenic
1138786370 16:59851401-59851423 GGGACCTGTCGGTAGGTGGAGGG - Intergenic
1139235276 16:65331687-65331709 GGGATCTATTGGAGGGTGGAGGG - Intergenic
1140152030 16:72377331-72377353 GGGACCTATTGGAGGGTAGAGGG + Intergenic
1140641512 16:76978657-76978679 GGGGCCTGTTGGAGGGTGGGAGG - Intergenic
1140952656 16:79834019-79834041 GGGGCCTATTGGGAGGTGGGGGG - Intergenic
1141311670 16:82919363-82919385 GGGACCTATTTGAGGGTGGAGGG - Intronic
1141663314 16:85453279-85453301 GGGAGGTAGAGGAGGGTGGGCGG - Intergenic
1144168557 17:12636042-12636064 GGGGCCTTTTGGAAGGTGGAGGG - Intergenic
1144476363 17:15592626-15592648 GAGACATATAGGAGAGTGGGGGG - Intronic
1144541122 17:16144604-16144626 GGGGCCTATTAGAAGGTGGAGGG - Intronic
1144777906 17:17794001-17794023 TGGAACTGTAGGAAGGTGAGCGG - Exonic
1146532747 17:33623880-33623902 GTGACAGATGGGAAGGTGGGGGG - Intronic
1146556642 17:33830716-33830738 GGGACCTGTCGGAGGGTAGGGGG - Intronic
1146607699 17:34275438-34275460 GGGGCCTTTTGGAGGGTGGGGGG - Intergenic
1146630787 17:34467890-34467912 GGGATATACAGGAAGGTGGAGGG - Intergenic
1146734950 17:35230769-35230791 GGGGCCTTTTGGAGGGTGGGAGG - Intergenic
1147313545 17:39608159-39608181 GGGATTGAGAGGAAGGTGGGAGG + Intronic
1147417014 17:40299419-40299441 GGGGCCTATAGGAGGGTGGAGGG - Intronic
1150611610 17:66738047-66738069 GGGACAGATAGGAAGATGGAGGG - Intronic
1150698496 17:67426597-67426619 GGGGCCTGTTGGAGGGTGGGGGG + Intronic
1150811773 17:68362452-68362474 GGGACCTGGAGGACGGTGTGTGG - Intronic
1151076411 17:71278609-71278631 GGGACCTGTTGGTGGGTGGGGGG - Intergenic
1152456181 17:80417603-80417625 GGGGCCTCTAGGGAGGTGAGTGG - Intronic
1152859376 17:82686825-82686847 GGAACGTGGAGGAAGGTGGGGGG - Intronic
1152902976 17:82955987-82956009 GGGACCTGTTGGAGGGTGGGGGG + Intronic
1153565173 18:6412139-6412161 GGGACCTATCGAAGGATGGGAGG - Intronic
1153649116 18:7223911-7223933 TGGCCCTAGAGGAAGGTGGGTGG + Intergenic
1154511303 18:15105421-15105443 GGGGCCTAGAGGCAGGTGGCAGG + Intergenic
1154985985 18:21551339-21551361 GGCACCTGTAGGAACCTGGGAGG + Intronic
1155131283 18:22937212-22937234 GGGACCTACATGAGGGTGGAGGG - Intronic
1155582731 18:27328845-27328867 GGGACCTATTGCAAGGTGGACGG + Intergenic
1155616717 18:27729773-27729795 GGGGCCTATTGGAGGGTGGAGGG - Intergenic
1155787923 18:29925415-29925437 GGGGCCTTTTGGGAGGTGGGGGG - Intergenic
1156145684 18:34174679-34174701 GGGGCCTGTCGGGAGGTGGGGGG - Intronic
1156342983 18:36228669-36228691 GAGACCTACAGGAGGGTGGAGGG + Intronic
1156512421 18:37650344-37650366 GGGGCCTATTGCAGGGTGGGGGG + Intergenic
1157155939 18:45266128-45266150 GAGACCTACAGGAAGGATGGAGG + Intronic
1157741799 18:50100010-50100032 GGCACCTATAGTGATGTGGGAGG - Intronic
1158029997 18:52951435-52951457 GGGACCTGTCGGGGGGTGGGAGG - Intronic
1158079872 18:53577164-53577186 GGGACCTGGTGGGAGGTGGGAGG + Intergenic
1158592871 18:58792155-58792177 GGCACATATAAGAAGGAGGGAGG - Intergenic
1159635773 18:70803118-70803140 GGGGCCTATTGGAGGGTGGAGGG + Intergenic
1160112128 18:76043235-76043257 GGGACCTATAGGATGAGAGGAGG + Intergenic
1160253504 18:77225411-77225433 GGGGCCCATAGGAGGGTGGAGGG - Intergenic
1161518213 19:4708772-4708794 GGGGCCTATTGGAGGGTGGAGGG + Intronic
1161833631 19:6629555-6629577 GGGACCTAGAGGGAGGTGATTGG - Intergenic
1162326057 19:10000347-10000369 GTGACCTGGAGGAAGATGGGAGG - Intronic
1162326145 19:10000927-10000949 GGGACCTATCGGAGGGTGGAGGG + Intronic
1162864593 19:13535206-13535228 GGGGCCTTTTTGAAGGTGGGGGG + Intronic
1163071089 19:14842220-14842242 GGGACCTATTTGAGGGTGGAAGG - Intergenic
1163257834 19:16168288-16168310 GGGACAGAAAGGAAGCTGGGAGG + Intronic
1163412761 19:17166655-17166677 GGGGCCTATTGGAGGGTGGAGGG - Intronic
1164942326 19:32260701-32260723 GGGGCCTATCAGAAGGTGGAGGG + Intergenic
1165107375 19:33479573-33479595 GGGGCCTATTGGAAGGTGGAGGG - Intronic
1165290252 19:34878020-34878042 GGAGCCTATTGGAAGGTGGAGGG - Intergenic
1166333464 19:42091673-42091695 GGGACCGATGGGGAGATGGGGGG - Intronic
1166335341 19:42102917-42102939 GGGACTTGTAGGCAGGTGAGGGG - Intronic
1166405474 19:42518915-42518937 GGGACATATAGGAAGGGGTGAGG + Intronic
1166412427 19:42564910-42564932 GGGACCCAGAGGAAGGTCTGAGG - Intergenic
1167804060 19:51767084-51767106 GGGGCCTACCGGAAGGTGGAGGG - Intronic
1168076515 19:53983085-53983107 GGGATCTATGGGGAGGGGGGAGG + Exonic
925698679 2:6611017-6611039 GGGGCCTGTTGGAGGGTGGGGGG - Intergenic
926231958 2:11011100-11011122 GGGGCCTATCGGAGGGTGGAGGG + Intergenic
926783616 2:16498556-16498578 GGGGCCTATTGGAGGGTGGACGG - Intergenic
926935321 2:18081603-18081625 GGGGCCTATCGGGGGGTGGGCGG + Intronic
927632606 2:24787439-24787461 GGGACTGATTGGAGGGTGGGAGG - Intergenic
928801502 2:35099476-35099498 GGGGCCTGTAGGAGGGTGGGAGG - Intergenic
929279149 2:40059376-40059398 GGGGCCTATCGGAGGGTGGAGGG + Intergenic
929527248 2:42716483-42716505 GGGGCCTATTGGAGGGTGGAGGG - Intronic
930448293 2:51501806-51501828 GGGTCCTGTTGGAGGGTGGGAGG - Intergenic
930572719 2:53107411-53107433 GGGGCCTATTGGAGGGTGGAGGG + Intergenic
930590345 2:53319624-53319646 GGGGCCTTTTGGAAGGTGGGTGG - Intergenic
930625182 2:53688773-53688795 GGGGCCTGTTGGGAGGTGGGGGG + Intronic
930664530 2:54088866-54088888 GTGACCGATAGGAATGTGTGTGG - Intronic
930820743 2:55643807-55643829 GGGACCTATTAGTAGCTGGGTGG + Intronic
931221306 2:60290617-60290639 GGGAACTAAAGGAAGGTGGGTGG + Intergenic
931798396 2:65734209-65734231 GGGGCCTATCGGAGGGTGGAGGG - Intergenic
932795017 2:74686866-74686888 GGGGCCTGTTGGAGGGTGGGGGG + Intergenic
933064434 2:77776439-77776461 GGGGCCTATAGGATGATGGAGGG - Intergenic
933420443 2:82038712-82038734 GGGACCTAGTGGAAGGTGATTGG - Intergenic
933506176 2:83179978-83180000 GGGGCCTATAGGGGAGTGGGAGG - Intergenic
933602893 2:84351078-84351100 GGGGCCTATTGTAAGGTGGAGGG + Intergenic
933716039 2:85361623-85361645 GGGGCCTATTGGAAAGTGGAGGG + Intronic
933893049 2:86788903-86788925 GGGACCCAAAGCAGGGTGGGCGG + Intronic
934127202 2:88907346-88907368 TGGGCCTATAGGAGGGTGGAGGG + Intergenic
934787251 2:97020811-97020833 GGGGCCTATAGGAGGGTTGGGGG + Intergenic
935884755 2:107604538-107604560 GGGGCCTATAGGGAGGTGAGGGG + Intergenic
936003001 2:108852739-108852761 GGGGCCTATCAGAGGGTGGGAGG + Intronic
936719998 2:115239754-115239776 GGGGCCTGTCGGAGGGTGGGGGG - Intronic
937137648 2:119568492-119568514 GGGGCCTGTCGGGAGGTGGGGGG - Intronic
937540744 2:122949640-122949662 GGGGCCTTTTGGAAGGTGGAGGG - Intergenic
938506517 2:131889878-131889900 GGGGCCTAGAGGCAGGTGGCGGG + Intergenic
938706900 2:133939374-133939396 GGGACCTGTTGTCAGGTGGGGGG + Intergenic
938885517 2:135643951-135643973 GGGGCTTATTGGAAGGTGGAGGG + Intronic
939147917 2:138438570-138438592 GGGGCCTATTGGAGGGTGGAGGG - Intergenic
939640341 2:144633390-144633412 GGGGCCTGTCAGAAGGTGGGAGG - Intergenic
939655413 2:144818277-144818299 GGGGCCTGTCGGAGGGTGGGAGG + Intergenic
940062699 2:149590024-149590046 TAGAGGTATAGGAAGGTGGGAGG - Intergenic
940437829 2:153675533-153675555 GGGGCCTGTTGGCAGGTGGGGGG + Intergenic
940527719 2:154839098-154839120 AGGGCCTATCGGGAGGTGGGGGG - Intronic
940553692 2:155194707-155194729 GGGACTGACAGGAAGGTGAGGGG + Intergenic
940904763 2:159159077-159159099 GGGCCCTATAGGTAGTTTGGTGG - Intronic
941119855 2:161515635-161515657 GGGGCCTGTAGCAGGGTGGGGGG + Intronic
942832399 2:180252586-180252608 GGGACCTGTTGGAAGGTTGGGGG - Intergenic
943143547 2:184013742-184013764 GGGACCTATAGGAAAGAAGAAGG + Intergenic
943453021 2:188069593-188069615 GGGGCCTATTTGAAGGTGGAGGG - Intergenic
943844390 2:192625262-192625284 GGGTCTTATAGGAGGGTGGCTGG - Intergenic
943871374 2:193005300-193005322 GGGGCCTGTTGGCAGGTGGGCGG - Intergenic
943993529 2:194730158-194730180 GGGGCCTGTTGGAAGGTGGAGGG + Intergenic
943997646 2:194791260-194791282 GGGGCCTATTGGAACGTGGAGGG - Intergenic
944360834 2:198854264-198854286 GGGACCTACTGGAGGGTGGAAGG + Intergenic
944456964 2:199905191-199905213 GGGACCTAATGGAAGGTGTTTGG + Intergenic
944989750 2:205221941-205221963 GGGGCCTATTGGAGGGTGGAGGG + Intronic
945148020 2:206759136-206759158 GGGGCCTATCGGAGGGTGGAGGG - Intronic
945177406 2:207056565-207056587 GGGACCTATTAGAGGGTGGAGGG + Intergenic
945223066 2:207504322-207504344 GGGGCCTATTGGAGGGTGGAGGG + Intergenic
945344753 2:208700264-208700286 GGGGCCTATAGGAGGGTGAGAGG - Intronic
945785718 2:214234038-214234060 GGGGCCTATTGAAAGGTGGCAGG - Intronic
945790866 2:214304011-214304033 GGGGCCTACTGGAAGGTGGAGGG - Intronic
946103245 2:217345691-217345713 GGGGCCTACTGGAAGGTGGAGGG - Intronic
948330635 2:237161622-237161644 GGGAGCTTTAGGAAGGAAGGTGG + Intergenic
948811992 2:240483837-240483859 GGGACCTGTTGGTGGGTGGGGGG - Intronic
1169016933 20:2299664-2299686 GGCAGCTATAGGAAGGAGGCAGG - Intronic
1169413416 20:5394114-5394136 GGGGCCTGTCGGGAGGTGGGGGG - Intergenic
1169562505 20:6817260-6817282 GGGGCCTTTTGGAGGGTGGGGGG + Intergenic
1169581649 20:7030004-7030026 GAGACCTATTGGAAGCTGAGTGG + Intergenic
1169834463 20:9862495-9862517 ACGGCCTAAAGGAAGGTGGGAGG + Intergenic
1169856502 20:10109324-10109346 GGGGCCTATTGGAAGGTGGAGGG + Intergenic
1170131538 20:13025884-13025906 GGGACCTAATGGAGGGTGGAGGG - Intronic
1170162558 20:13328794-13328816 GGGACCTGTAGGAGGGTGGGGGG + Intergenic
1171286453 20:23942992-23943014 GGGACCTAGTGGAAGGTGATTGG + Intergenic
1172310377 20:33913442-33913464 GCTACCTATTGGAATGTGGGGGG - Intergenic
1174193665 20:48757809-48757831 TGGACCTATAGAAATGTTGGAGG + Intronic
1174449577 20:50610971-50610993 AGGACCTGTAGGAGGGTGGCAGG - Intronic
1174855023 20:54036041-54036063 GGGGCCTATTGGAGGGTGGAAGG + Intronic
1175011055 20:55736520-55736542 GGGCCCTTTAGGAGGGTGGAGGG + Intergenic
1175414352 20:58792077-58792099 GGGAACAAAAGGAAGGTAGGAGG - Intergenic
1176162843 20:63657305-63657327 GGGACCTGGAGGGAGGTGGTTGG - Intergenic
1177493388 21:21857242-21857264 GGGGCCTATTGGCAGGTGGAAGG + Intergenic
1177648361 21:23928709-23928731 GGGGCCTGTCGGAGGGTGGGGGG + Intergenic
1177769554 21:25499372-25499394 GGGGCCTGTCAGAAGGTGGGGGG + Intergenic
1178005212 21:28211371-28211393 GGGTCCTATCAGAAGGTGGAGGG - Intergenic
1178815002 21:35921224-35921246 GGGGCCTATAGGAAGGTGAAGGG + Intronic
1178955989 21:37022359-37022381 GGGGCCCATAGGAGGGTGGTGGG - Intergenic
1179062442 21:37991387-37991409 AGGACCTGTCGGGAGGTGGGGGG + Intronic
1179172522 21:38983565-38983587 GGGGCCTTTTGGAGGGTGGGAGG - Intergenic
1179533637 21:42037390-42037412 GGGGCCTGTTGTAAGGTGGGGGG + Intergenic
1180759335 22:18187653-18187675 GGGGCCTACTGGAGGGTGGGAGG + Intergenic
1180769643 22:18371949-18371971 GGGGCCTACTGGAGGGTGGGAGG + Intergenic
1180776685 22:18490717-18490739 GGGGCCTACTGGAGGGTGGGAGG - Intergenic
1180809412 22:18748083-18748105 GGGGCCTACTGGAGGGTGGGAGG - Intergenic
1180827583 22:18874912-18874934 GGGGCCTACTGGAGGGTGGGAGG + Intergenic
1181046667 22:20217879-20217901 GTTACCTAGAGGGAGGTGGGGGG - Intergenic
1181072333 22:20353069-20353091 GGGGCCTACTGGAGGGTGGGAGG - Intronic
1181195404 22:21182003-21182025 GGGGCCTACTGGAGGGTGGGAGG - Intergenic
1181214043 22:21310771-21310793 GGGGCCTACTGGAGGGTGGGAGG + Intergenic
1181724674 22:24803720-24803742 GGGTACTTTAGGAAGGTGGTAGG - Intergenic
1181885101 22:26015639-26015661 GGGGCCTATCAGAAGGTGGAGGG + Intronic
1182058084 22:27376424-27376446 GGGACCTGTCAGAGGGTGGGGGG + Intergenic
1182205075 22:28615783-28615805 GGGGCCTGTAGGGGGGTGGGGGG + Intronic
1183699310 22:39441486-39441508 GGGACCTTTCAGAAGGTGGAGGG + Intergenic
1184041184 22:41945085-41945107 GGGGCCTATCGGAGGGTGGAGGG - Intronic
1184526992 22:45030078-45030100 GGGACAGCTAGGAAGGTGGGGGG - Intergenic
1184829143 22:46972899-46972921 GGGACCTGCGGGAACGTGGGAGG - Intronic
1203231474 22_KI270731v1_random:113136-113158 GGGGCCTACTGGAGGGTGGGAGG + Intergenic
1203277680 22_KI270734v1_random:100902-100924 GGGGCCTACTGGAGGGTGGGAGG + Intergenic
949273766 3:2254041-2254063 GGGGCCTGTAGGGGGGTGGGGGG - Intronic
949393804 3:3593089-3593111 GGGGCCTATCGGAGGGTGGAGGG + Intergenic
949409856 3:3751965-3751987 GGGGCCTATTGGAGGGTGGGAGG - Intronic
950161254 3:10762989-10763011 GGGACCCAAAGGCTGGTGGGAGG - Intergenic
950564570 3:13760329-13760351 GGGGCCTATATGAAGGTGGAAGG + Intergenic
950610109 3:14121186-14121208 GGGACACAGAGGGAGGTGGGGGG - Intronic
950798690 3:15531960-15531982 GGGTCCTGAAGGAAGGAGGGAGG - Intergenic
951096529 3:18638256-18638278 GGGGCCTATTGGAGGGTGGAAGG + Intergenic
951104159 3:18723777-18723799 GGGACCTGGTGGGAGGTGGGAGG - Intergenic
951618316 3:24572777-24572799 GGGGCCTATAGTGGGGTGGGGGG + Intergenic
951674018 3:25216572-25216594 GGGGCCTATTGGGGGGTGGGGGG + Intronic
951869098 3:27340346-27340368 GGGGCCTATTGGGTGGTGGGTGG + Intronic
953885465 3:46712364-46712386 GAGACCTGTAGGTAGATGGGTGG + Exonic
954362064 3:50127209-50127231 GGGGCCTATAGCAAGGAGGCTGG - Intergenic
954602518 3:51880610-51880632 GGGGCCTATTGGAGGGTGGATGG + Intergenic
954797838 3:53170502-53170524 GGGCCCTGCAGGCAGGTGGGCGG + Intronic
954939546 3:54358908-54358930 AGGAAGTAAAGGAAGGTGGGAGG - Intronic
955937807 3:64119209-64119231 GGGATCTATTGGAGGGTGGAGGG + Intronic
956071767 3:65460698-65460720 GGGACCTGTTGGAGGGTGGTGGG - Intronic
956246243 3:67186479-67186501 GGGTTCTAGAGGATGGTGGGTGG + Intergenic
956689959 3:71867075-71867097 GGGGCCTATTGGAGGGTGGAGGG + Intergenic
957028855 3:75216635-75216657 GGGGCCTATTGGAGGGTGGAGGG + Intergenic
957426708 3:80049693-80049715 GGGGCCTGTCGGGAGGTGGGAGG - Intergenic
957649625 3:82982817-82982839 GGGTCCTATTGGAGGGTGGAGGG + Intergenic
957777046 3:84766988-84767010 GGGGCCTATCAGGAGGTGGGGGG + Intergenic
957888510 3:86323815-86323837 GGGGCCTGTTGGGAGGTGGGAGG + Intergenic
957931698 3:86886781-86886803 GGGGCCTGTCGGAGGGTGGGGGG + Intergenic
958261293 3:91384164-91384186 GGAGTCTAGAGGAAGGTGGGTGG + Intergenic
958626837 3:96636920-96636942 AGGACCTATAGGATGGTGGAAGG - Intergenic
958684016 3:97369375-97369397 TGGACATATAGAAAAGTGGGTGG + Intronic
958756138 3:98251374-98251396 GGGACCTATTGGAGGATGGAGGG + Intergenic
958954023 3:100447438-100447460 GGGGCCTGTTGGAGGGTGGGAGG + Intronic
958954701 3:100455064-100455086 GGGACCTACTGGAGGGTGGGGGG - Intronic
959107620 3:102082613-102082635 GGGGCCTATTGGAAGGTGGAGGG + Intergenic
959326720 3:104946172-104946194 GGCACCTACTGGAAGGTGGAGGG - Intergenic
959522925 3:107340629-107340651 GGGGCCTATAGGAGGGTGGAGGG - Intergenic
959672583 3:108995979-108996001 GGGACAGTTATGAAGGTGGGAGG + Intronic
959688726 3:109176151-109176173 GGGGCCTGTTGTAAGGTGGGGGG - Intergenic
961008128 3:123418674-123418696 GGGGCCTAGTGGAAGGTGTGTGG - Intronic
961335054 3:126170858-126170880 GGGACACAAAGGGAGGTGGGGGG + Intronic
962062698 3:131947388-131947410 GGGGCCTATTGGGGGGTGGGAGG - Intronic
962464494 3:135644593-135644615 AGGGCCTATCGGAGGGTGGGAGG - Intergenic
962658798 3:137579555-137579577 GGGGACTATCGGGAGGTGGGGGG - Intergenic
963019891 3:140863133-140863155 GGGACCTATCGGAAGGTGGAAGG + Intergenic
963351385 3:144156103-144156125 GGGGCCTATTGGAGGGTGGAGGG + Intergenic
963587742 3:147214460-147214482 GGGGCCTATCAGAAGGTGGAGGG - Intergenic
964186170 3:153946211-153946233 GGGACCTAGTGGGAGGTGGTTGG + Intergenic
964594537 3:158409122-158409144 GGGGCCTATTGGAAGGTGGAGGG + Intronic
964675931 3:159279804-159279826 GGGAACTAAAGGAAGTTGGTTGG + Intronic
964759571 3:160121919-160121941 GGGGCCTATTGGGGGGTGGGGGG + Intergenic
964987349 3:162760459-162760481 AGGACCTATTTGAAGGTGGAGGG - Intergenic
965415868 3:168391409-168391431 GGGGCCTATAAGAGGGTGGAGGG + Intergenic
965558497 3:170040013-170040035 GGGGCCTGTCGGAGGGTGGGGGG + Intronic
965830560 3:172782691-172782713 GGGGCCTACTGGAAGGTGGAGGG - Intronic
965881249 3:173391199-173391221 GAGACCTATACGAATGAGGGAGG + Intergenic
966317222 3:178661139-178661161 GGGGCCTGTCGGAGGGTGGGGGG - Intronic
966488380 3:180497910-180497932 GGGGCCTGTAGGAGGGTGGGAGG - Intergenic
967392425 3:188970075-188970097 GGGGCCTGTTGGAGGGTGGGGGG - Intronic
967670781 3:192232704-192232726 GGGACCTATTTGAAGGTGGAGGG - Intronic
968660539 4:1797028-1797050 GGGATCCATAGAAGGGTGGGAGG + Intronic
969082592 4:4630816-4630838 GGGGCCTATAGGAGGGTGGAGGG + Intergenic
969728349 4:8939076-8939098 AGGACCGTCAGGAAGGTGGGAGG - Intergenic
970180885 4:13391894-13391916 GGGGCCTGTCGGGAGGTGGGGGG + Intronic
970856535 4:20655518-20655540 GGGACCTAGTGGGAGGTGAGTGG + Intergenic
971224476 4:24738200-24738222 GGGACCTAGTGGAAGGTGATTGG + Intergenic
971674771 4:29612226-29612248 GGGGCCTGTCGGGAGGTGGGGGG - Intergenic
971947408 4:33299212-33299234 GGGGCCTATTGGAGGGTGGAAGG - Intergenic
972045137 4:34655765-34655787 GGGGCCTATCGGAGGGTGGAGGG + Intergenic
972151200 4:36093193-36093215 GGGGCCTATTGGAAGGCGGAGGG + Intronic
972300788 4:37783999-37784021 GGGGCCTATTGGAAGGTGGAAGG - Intergenic
972698993 4:41475702-41475724 GGGGCCTGTTGGAGGGTGGGGGG + Intronic
972756111 4:42048066-42048088 GGGGCCTATTGGGGGGTGGGTGG + Intronic
972924278 4:43984306-43984328 GAGGCCTATTGGAAGGTGGAGGG + Intergenic
973813167 4:54593017-54593039 GGGGCCTATTGGAGGGTGGACGG + Intergenic
973928157 4:55760945-55760967 GGGGCCTGTCGGGAGGTGGGGGG + Intergenic
974316484 4:60288295-60288317 GGGGCCTGTCAGAAGGTGGGAGG + Intergenic
974901684 4:68007049-68007071 GGGGCCTGTTGGAAGGCGGGTGG + Intergenic
975168443 4:71205018-71205040 AGGACCTTTAGGAAGGAGGTGGG + Intronic
975254137 4:72214217-72214239 GGGGCCTATTGGAGGGTGGAGGG + Intergenic
975286187 4:72623773-72623795 GGGACCTACTTGAAGGTGGAGGG - Intergenic
975524833 4:75337516-75337538 GGGGCCTGTTGGGAGGTGGGGGG + Intergenic
975946416 4:79710944-79710966 GGGGCCTATTGCAAGGTGGAGGG - Intergenic
976073730 4:81272872-81272894 GGGACCTATAGGGGAGTGGAGGG - Intergenic
976079354 4:81337775-81337797 GGGGCCTATAGGAGGGTGAAGGG - Intergenic
976087844 4:81424501-81424523 GGGACTGCTGGGAAGGTGGGGGG - Intergenic
976232144 4:82855778-82855800 GGGGCCTATTGGAGGGTGGGAGG + Intronic
976653285 4:87459272-87459294 GGGGTCTATTGGAGGGTGGGAGG + Intronic
976983261 4:91259593-91259615 GGGGCCTGTTGGAGGGTGGGGGG - Intronic
976995405 4:91426040-91426062 GGGGCCTATTGGGATGTGGGGGG - Intronic
977154206 4:93552785-93552807 GGGGCCTATTGGGGGGTGGGGGG - Intronic
977154939 4:93560067-93560089 GGGGCCTGTCAGAAGGTGGGGGG + Intronic
977256533 4:94747051-94747073 GGGGCCTTTTGGAAGGTGGAAGG + Intergenic
978551612 4:109933574-109933596 GGGGCCTGTTGGGAGGTGGGGGG - Intronic
978554887 4:109969442-109969464 GGGGCCTTTTGGAGGGTGGGTGG + Intronic
979000425 4:115210350-115210372 GGGGCCTGTCGGAGGGTGGGGGG + Intergenic
979141165 4:117176575-117176597 GGGGCCTATAGAAGGGTGGAGGG - Intergenic
980398864 4:132253431-132253453 AGGGCCTATTGGAAGGTGGAGGG - Intergenic
981750452 4:148088703-148088725 GGGGCCTGTTGGAGGGTGGGGGG + Intronic
981949261 4:150386419-150386441 GGGGCCTCTTGGAGGGTGGGGGG - Intronic
983113980 4:163789336-163789358 GGGGCCTTTAGGAGGGTGGAGGG + Intronic
983688388 4:170437639-170437661 GGGGCCTATTGGGGGGTGGGGGG + Intergenic
983689773 4:170454067-170454089 GGGGCCTATTGGAAGGTGGAGGG - Intergenic
983903898 4:173165586-173165608 GGGGCCTATTGGAGGGTGGAGGG - Intergenic
984193425 4:176631100-176631122 GGGACCTGTCGGGAGGTGGGGGG + Intergenic
984305246 4:177981005-177981027 GGGACCTATATGAGGATGGAGGG - Intronic
984463070 4:180059460-180059482 GGAACCGAGAGGAGGGTGGGGGG + Intergenic
985327574 4:188789184-188789206 GGGGCCTATTGGAGGGTGGAAGG - Intergenic
986228465 5:5839255-5839277 GGGGGCTATAGGAGGGTGGAGGG + Intergenic
986613389 5:9592131-9592153 GGGGCCTGTCGGCAGGTGGGAGG + Intergenic
986917521 5:12640258-12640280 GGGGCCTGTCGGGAGGTGGGGGG + Intergenic
987352063 5:17031020-17031042 GGGACCTATTGGAGGGTGGAGGG + Intergenic
987593981 5:19971681-19971703 GGGACCTTTCCGAAGGTGGAGGG + Intronic
988311973 5:29571156-29571178 GGGACCTGTCGGTGGGTGGGGGG - Intergenic
988667723 5:33348318-33348340 GGGACCTGTTGTAGGGTGGGGGG - Intergenic
988693233 5:33593669-33593691 GGGGCCTGTAGGGAGTTGGGGGG + Intronic
988871069 5:35390565-35390587 GGGACCTATGGGAAAGTGGAGGG + Intergenic
989085618 5:37673054-37673076 GGGGCCTATGGGAGGGTGGAGGG - Intronic
989589486 5:43100291-43100313 GGGACCTAAAGGGAGGTGTTTGG - Intronic
989630308 5:43475364-43475386 AGGGCCTATAGGTGGGTGGGGGG + Intronic
989680736 5:44026971-44026993 GGGGCCTATTGGAAGGTGGGAGG - Intergenic
989685501 5:44081860-44081882 GGGGCCTGTCGGGAGGTGGGGGG - Intergenic
989784468 5:45311002-45311024 GGGGCCTATCGGAGGGTGGAAGG + Intronic
989788209 5:45357808-45357830 GGGACCTATTGGAAAGTGTTCGG + Intronic
989822064 5:45804981-45805003 GGGACTTATTGGAGGGTCGGGGG - Intergenic
990391562 5:55326850-55326872 GGGGCCTGTAGAGAGGTGGGGGG - Intronic
990395920 5:55378176-55378198 GAGACTTACAGGAAGGTGGAAGG + Intronic
990504375 5:56430221-56430243 GGGACCTGAAGAAAGGTGGGTGG + Intergenic
991472597 5:66985002-66985024 GGGACTTTTAGGAAAGTAGGTGG + Intronic
991972032 5:72150654-72150676 GGGGCCTATCGGAGGGTGGAGGG - Intronic
992265680 5:75016127-75016149 GGGGCCTATTGGAGGGTGGGGGG + Intergenic
992459690 5:76948931-76948953 GGGGCCTATTGGAAGTTGGAGGG + Intergenic
992876422 5:81060160-81060182 GGGGCCTATTGGGAGGTGTGTGG - Intronic
993043514 5:82841882-82841904 GGGGCCTGTAATAAGGTGGGGGG - Intergenic
993201590 5:84822927-84822949 GGGGCCTATCGGGGGGTGGGGGG + Intergenic
993286563 5:86006818-86006840 GGGGCCTATCGGAAGGCAGGGGG - Intergenic
993330826 5:86597827-86597849 GGGGCCTGTTGGGAGGTGGGGGG + Intergenic
993556715 5:89348546-89348568 GGGACCTATCAGAGGGTGGAGGG + Intergenic
993673146 5:90786239-90786261 GGGGCCTATTGGGGGGTGGGGGG + Intronic
993921093 5:93803542-93803564 GGGGCCTATTGGAGGGTGGAGGG + Intronic
993972377 5:94435288-94435310 GGGGCCTGTTGGAGGGTGGGGGG - Intronic
994284793 5:97951636-97951658 GGGACTTATTGGAAGGTGGAGGG - Intergenic
994619808 5:102149747-102149769 GGGGCCTATCAGAAGGTGGATGG + Intergenic
994691630 5:103026831-103026853 GGGGCCTAGGGGAAGGTGGCAGG + Intronic
995211521 5:109544912-109544934 GAGACCTATAGGAGGGTAGTGGG - Intergenic
995213225 5:109564687-109564709 AGGGCCTGTTGGAAGGTGGGGGG - Intergenic
995267907 5:110186280-110186302 GGGGCCTGTAGGGGGGTGGGGGG - Intergenic
995340391 5:111052262-111052284 GAGGCCTATTGGGAGGTGGGGGG - Intergenic
995554997 5:113318669-113318691 GGGGCCTATGGGAGGGTGGAGGG + Intronic
995919349 5:117292816-117292838 GGGGCCTATTGGAGGGTGGATGG - Intergenic
995998048 5:118324234-118324256 GGGACCTCATGGGAGGTGGGAGG - Intergenic
996125688 5:119723046-119723068 GGGGCCTGTTGGGAGGTGGGAGG - Intergenic
996424713 5:123301778-123301800 GGGGCCTATCGGAGGGTGGAGGG + Intergenic
996698926 5:126429372-126429394 GGGATCTATTGGAGGGTGGAGGG + Intronic
996777986 5:127153541-127153563 GGAGCCTGTTGGAAGGTGGGCGG - Intergenic
996928562 5:128858611-128858633 GGGCCCTATTGGAGGGTGGAGGG - Intronic
997049225 5:130358902-130358924 GGGGCCTATTGGAGGGTTGGGGG + Intergenic
997171262 5:131723862-131723884 AGGACCTATTGGGGGGTGGGGGG - Intronic
998604791 5:143622528-143622550 GGGACCTGTTGGAGGGTGGGGGG + Intergenic
998631510 5:143904003-143904025 GGGGCCTATAAGAGGGTGGGGGG - Intergenic
998962012 5:147498089-147498111 GGGGCCTATTGGAGGGTGGAGGG - Intronic
998983951 5:147734489-147734511 GGGGCCTGTTGGAGGGTGGGGGG + Intronic
999503149 5:152166742-152166764 AGGACCTATATGAAGGTGAGTGG - Intergenic
999777435 5:154822406-154822428 GAGACCTTCAGGAAGGTGGTTGG + Intronic
999904792 5:156128589-156128611 GGGACCTGGAGGAAGGTGATTGG + Intronic
1000372631 5:160551756-160551778 GGGACCTATTGGAGGGTGGGAGG - Intergenic
1000473235 5:161672429-161672451 GGGGCCTTTTGGAAGGTGGAAGG - Intronic
1001128625 5:169044571-169044593 GGGGGCTGGAGGAAGGTGGGGGG + Intronic
1001290640 5:170456298-170456320 GGGGCCTGTCGGAGGGTGGGGGG + Intronic
1001402116 5:171451672-171451694 GTGTCCCATAGCAAGGTGGGAGG - Intronic
1001898902 5:175406184-175406206 GGGGCCTATCGGAGGGTGGACGG - Intergenic
1002657830 5:180766568-180766590 GGGGCCTATCTGAAGGTGGATGG + Intergenic
1003276630 6:4659500-4659522 GGGACCTGTAGTGGGGTGGGGGG - Intergenic
1003385864 6:5667040-5667062 GGGGCCTATCGGAGGGTGGAGGG + Intronic
1003823917 6:9931240-9931262 GGGGCCTATTGGAAGGTGGAAGG + Intronic
1004087004 6:12459562-12459584 GGAACCTATAGGAAATTGAGTGG - Intergenic
1005128452 6:22474994-22475016 GGGACCTGTCGGGGGGTGGGGGG + Intergenic
1005761098 6:28969071-28969093 GAGACCAATAGGAAGTTCGGAGG - Intergenic
1005917847 6:30369651-30369673 GGGGCCTATTGGAGGCTGGGAGG + Intergenic
1006494553 6:34412743-34412765 GTGAACAATACGAAGGTGGGAGG - Intronic
1006871649 6:37257536-37257558 GGGACCTATGGGAAGGAAGAGGG - Intronic
1007327236 6:41072271-41072293 GGGTCCTATGGGAGGGTGCGGGG + Intronic
1007573137 6:42907605-42907627 GGGAGCTAGACCAAGGTGGGGGG + Intergenic
1007947711 6:45840850-45840872 GGGGCCTGTCGGGAGGTGGGGGG - Intergenic
1008204617 6:48639507-48639529 GGGGCCTAATGGAAGGTGGCAGG + Intergenic
1008255507 6:49295154-49295176 GGGGCCTACAAGAGGGTGGGAGG + Intergenic
1008688586 6:53951757-53951779 GGGACCTATTGGAGGGTGGAGGG + Intronic
1008729880 6:54468524-54468546 GGGGCCTATCGGAGGGTGGAGGG + Intergenic
1008853467 6:56052888-56052910 GGGGCCTACTGGAAGGTGGAGGG + Intergenic
1008993866 6:57635990-57636012 GGAGTCTAGAGGAAGGTGGGTGG - Intronic
1009042307 6:58193721-58193743 GGGACCTTTTGGAGGGTGGAGGG - Intergenic
1009182475 6:60535074-60535096 GGAGTCTAGAGGAAGGTGGGTGG - Intergenic
1009218146 6:60947941-60947963 GGGACCTTTTGGAGGGTGGAGGG - Intergenic
1009382618 6:63051794-63051816 GGGGCCTATGGGAGGGTGGAAGG - Intergenic
1009874562 6:69489538-69489560 GGGGCCTACTGGAAGGTGGAGGG - Intergenic
1010138253 6:72581341-72581363 GGGGCCTATCGGTTGGTGGGGGG - Intergenic
1010256777 6:73767209-73767231 GGGTCCTATGGGAGGGTGGAGGG - Intronic
1010377008 6:75182363-75182385 GGGACCTATAGGAAGGTGGGGGG - Intronic
1010456073 6:76057134-76057156 GGGGGCTGTTGGAAGGTGGGAGG + Intronic
1010619484 6:78056468-78056490 GGGGCCTATTGGAGGGTGGAGGG - Intergenic
1010708203 6:79139513-79139535 GGGACCTATTGGGGGGTGGAGGG + Intergenic
1011200037 6:84826020-84826042 GGGGCCTATCGGAAGGTGGAGGG - Intergenic
1011297742 6:85841595-85841617 GGGGCCTGTTGGAGGGTGGGGGG - Intergenic
1011653005 6:89524301-89524323 GGGACTCAGGGGAAGGTGGGAGG - Intronic
1011718598 6:90132392-90132414 GGTAGACATAGGAAGGTGGGAGG - Intronic
1012078379 6:94724632-94724654 GGGGCCTATTGGAAGGTGAAGGG + Intergenic
1012355337 6:98307558-98307580 GGGGCCTATTGGAGGGGGGGAGG - Intergenic
1012825032 6:104137176-104137198 GGGGCCTATTGGAAGGTGGAAGG - Intergenic
1012954883 6:105559030-105559052 TGAACCTTTAGGAAGGTGAGAGG - Intergenic
1013659101 6:112276445-112276467 GGGGCCTATTGGAGGGTGGAGGG - Intergenic
1013716698 6:112970776-112970798 GGGGCCTATTAGAAGGTGGGGGG + Intergenic
1013820647 6:114149570-114149592 GGGGCCTGTTGGCAGGTGGGGGG + Intronic
1014180676 6:118381007-118381029 GGGACCTGTAGGGGGGTGTGGGG + Intergenic
1014324370 6:119973831-119973853 GGGGCCTATAGGAGGGTGGAGGG + Intergenic
1014827003 6:126058107-126058129 GGGGCCTGTCGGGAGGTGGGGGG - Intergenic
1014846323 6:126281907-126281929 GGGGCCTACTGGAGGGTGGGGGG - Intergenic
1014883824 6:126755953-126755975 GGGACCTAGTGGAAGGTGATTGG - Intergenic
1015084050 6:129265704-129265726 GGGGCCTGTCGGAGGGTGGGGGG + Intronic
1015194562 6:130510862-130510884 GGGACCTGTTGGAAGGTGACTGG + Intergenic
1015624442 6:135165810-135165832 GGGACCTACCTGAAGGTGGAGGG - Intergenic
1016487785 6:144562358-144562380 GGGGCCTGTAGGAAGGGGGCAGG - Intronic
1016733901 6:147455232-147455254 GGGGCCTATTGGAGGGTGGAGGG + Intergenic
1016977554 6:149824025-149824047 GCAACTTATAGGAAGGTGGAGGG - Intronic
1016990936 6:149927409-149927431 GGGCCCTATTGGGAGGTGAGGGG - Intergenic
1018156255 6:160988047-160988069 AGGGCCTATTGGAAGGTGGAGGG + Intergenic
1018759617 6:166880919-166880941 GGGCCCTACTGGAAGGTGGGGGG + Intronic
1019485581 7:1287894-1287916 GGGAGCCGCAGGAAGGTGGGGGG - Intergenic
1020450151 7:8312444-8312466 GGGATCTATAGGAGGTTGGAAGG - Intergenic
1020750362 7:12133186-12133208 GGGGCCTATTGGAGGGTGGAGGG + Intergenic
1020792714 7:12645645-12645667 GGGGCCTATCGAAAGGTGGAAGG - Intronic
1021378435 7:19937354-19937376 GGGACCTGTTGGGGGGTGGGGGG - Intergenic
1021426101 7:20501470-20501492 GGGGCCTATTGGAGGGTGGAGGG - Intergenic
1021608837 7:22436547-22436569 GGGGCCTATTGGAGGGTGGAGGG - Intronic
1022020761 7:26398045-26398067 GGGAGCTATCAGAAGGCGGGAGG + Intergenic
1022157444 7:27674485-27674507 GGAGCCTGTAGGAGGGTGGGGGG + Intergenic
1022219471 7:28298231-28298253 GGGGCCTGTAGGAAGGTGGGTGG - Intergenic
1022623919 7:32014612-32014634 GGGGCCTGTCGGAAGGTGGAGGG - Intronic
1022686427 7:32601561-32601583 GGGGCCTGTCGGAGGGTGGGAGG + Intergenic
1022900901 7:34809785-34809807 GGGGCCTATAGGAGGGTGTAGGG - Intronic
1024414250 7:49083606-49083628 AGGGCCTGTAGGAGGGTGGGGGG + Intergenic
1024434010 7:49327512-49327534 GGGACCTAATGGAAGGTGTTTGG - Intergenic
1024544118 7:50502706-50502728 GGGAACTACTGGGAGGTGGGTGG - Intronic
1024885257 7:54134903-54134925 GGGGCCTATGGGAGGGTGGGGGG - Intergenic
1025867296 7:65395549-65395571 GGGACCTGGAGGAAGGTGCTTGG + Intronic
1026590759 7:71693635-71693657 GGGGCCTATTGGAGGGTAGGGGG + Intronic
1028034726 7:85967151-85967173 GGGACCTGTTGGGAGGTAGGGGG + Intergenic
1028318590 7:89434619-89434641 GGTACTCATAGGAAGGAGGGTGG - Intergenic
1028609124 7:92689249-92689271 GGGGCCTATTGGAGGGTGGAGGG - Intronic
1028951633 7:96643104-96643126 GGGACCTATTGGAGGTTGGATGG - Intronic
1029907634 7:104107538-104107560 GGGGCCTATCAGAGGGTGGGGGG - Intergenic
1029944446 7:104517131-104517153 GGGGCCTATCGGAGGGTGGAGGG + Intronic
1030077761 7:105751204-105751226 GGGATGGATGGGAAGGTGGGAGG + Intronic
1030308294 7:108041733-108041755 GGGGCCTTTTGGAAGGTGGAGGG + Intronic
1030377252 7:108767914-108767936 AGGACCTATTGGTGGGTGGGGGG - Intergenic
1030397563 7:109006580-109006602 GGGGCCTTTTGGAAGGTGGAGGG + Intergenic
1030871733 7:114764404-114764426 GGGACCTGTCGGGGGGTGGGGGG + Intergenic
1031180010 7:118402171-118402193 GGGGCCTACAGGAGGGTGGAAGG - Intergenic
1031260766 7:119517183-119517205 GGGGCCTATTGGGGGGTGGGAGG - Intergenic
1031394925 7:121261986-121262008 GGGACCTATTGGAAGTTGTTTGG + Intronic
1032358139 7:131229314-131229336 GGGGCCTGTGGGCAGGTGGGGGG - Intronic
1032462480 7:132122299-132122321 GGGGCCTATGGGTGGGTGGGTGG + Intergenic
1032586984 7:133156011-133156033 GGGACCTACTTGAAGGTGGAGGG + Intergenic
1033227747 7:139574671-139574693 AGGACCTGGAGGAAGGGGGGTGG - Intronic
1033416850 7:141169199-141169221 GGGGCCTATCGGATGGTGGAGGG - Intronic
1033493727 7:141871851-141871873 GGGGCCTGTAGGAGGGTGGGGGG + Intergenic
1033585740 7:142773192-142773214 AGGACCCATGGAAAGGTGGGAGG + Intergenic
1033993656 7:147318653-147318675 GGGGCCTATCGGGAGGTGGGGGG + Intronic
1034084157 7:148308728-148308750 GGGGCCTATTGGGGGGTGGGAGG - Intronic
1034678354 7:152909075-152909097 GGGGCCTGTCAGAAGGTGGGAGG - Intergenic
1035863084 8:3051432-3051454 GGGGCCTATGGGAGGGTGGAGGG + Intronic
1036253280 8:7182924-7182946 GGGCTCAATGGGAAGGTGGGAGG - Intergenic
1036364216 8:8104554-8104576 GGGCTCAATGGGAAGGTGGGAGG + Intergenic
1036894335 8:12620638-12620660 GGGCTCAATGGGAAGGTGGGAGG - Intergenic
1037869702 8:22481695-22481717 GGGGCCTATTGGTAGGTGGGGGG - Intronic
1039575723 8:38622524-38622546 GGGACCATGAGGACGGTGGGAGG - Intergenic
1040383973 8:46900772-46900794 GAGACCCAGAGGAAGGTGGTGGG + Intergenic
1040443501 8:47469709-47469731 GGGGCCTACTGGAGGGTGGGCGG + Intronic
1040672760 8:49712452-49712474 AGGGCCTATTGGAAGGTGGAGGG + Intergenic
1040843685 8:51811821-51811843 GGGTTGTATAGGTAGGTGGGTGG - Intergenic
1040954642 8:52967396-52967418 GGGACCTATGTGAAGGTGGAGGG - Intergenic
1041003105 8:53471181-53471203 AGGAATTATAGGAAGGTGAGGGG - Intergenic
1042628974 8:70795132-70795154 GGGGCCTATCAGAAGGTGGAGGG - Intergenic
1043194938 8:77280163-77280185 GGGGCCTATCAGAAGGTGGAGGG + Intergenic
1043992017 8:86766679-86766701 GGGGCCTATCGGAGGGTGGAGGG + Intergenic
1044187829 8:89277605-89277627 GGGACCTAGAGGGAGGTGATTGG + Intergenic
1045038944 8:98202443-98202465 GGGGCCTAGAGGAAGGTGTGTGG + Intronic
1045091797 8:98753459-98753481 GGGGCCTATCAGAAGGTGGAAGG + Intronic
1045148346 8:99373151-99373173 GGCACCTGTTGGGAGGTGGGGGG + Intronic
1045868174 8:106893134-106893156 GGGGCCTGTAGGAGGGTGGGGGG - Intergenic
1046447958 8:114347704-114347726 GGGGCCTTTAGGAAGGTGGAGGG + Intergenic
1046628395 8:116599338-116599360 GGGGCCTTTTGGAAGGTGGAGGG - Intergenic
1046715185 8:117559409-117559431 GGGGCCTATTGGGGGGTGGGGGG - Intergenic
1046856169 8:119034231-119034253 GGGACCTATTGGAGGATGGGGGG + Intronic
1047302002 8:123621523-123621545 AGGACCTGTGGGAAGGTGTGTGG + Intergenic
1047669712 8:127132158-127132180 GGGGCCTGTCGGAGGGTGGGGGG + Intergenic
1048158984 8:131993920-131993942 GGGACCTGTTGGAGGGTGGAGGG + Intronic
1048644848 8:136408608-136408630 GGGGCCTATTGGAGGGTGGAGGG + Intergenic
1048859004 8:138709626-138709648 GGGGCCTGTAGTAGGGTGGGGGG + Intronic
1048929338 8:139298714-139298736 GGGGCCTACTGGAGGGTGGGAGG - Intergenic
1049877750 8:145036861-145036883 GGGACCTAGTGGAAGGTGTTTGG + Intergenic
1050593683 9:7184957-7184979 GGGACCTCTAAGAAGGTAGGAGG + Intergenic
1050819434 9:9859007-9859029 GGGACCTATTGGGAGGTGATTGG + Intronic
1050963932 9:11772182-11772204 GGGGCCTGTAGGGGGGTGGGGGG + Intergenic
1051488523 9:17635140-17635162 GGGGCCTATAGGAGGGTGGTAGG - Intronic
1051498617 9:17752862-17752884 GGGACCTATTGGAGGGTGGAGGG - Intronic
1052335704 9:27317840-27317862 GGGGCCTGTCAGAAGGTGGGGGG - Intergenic
1052514279 9:29460168-29460190 GGGGCCTATTGGACGGTGGAGGG - Intergenic
1052627055 9:30989260-30989282 GGGACCTTTCAGAAGGTGGAGGG + Intergenic
1053408050 9:37894773-37894795 GGGGCCCATAGGAGGGTGGAGGG - Intronic
1054745681 9:68852051-68852073 GGGGCCTATCGGCAGGTGAGGGG + Intronic
1055175347 9:73311919-73311941 GGGGCCTGTAGGAAGGTAGGGGG + Intergenic
1055208778 9:73763986-73764008 GGGACCTATTGGAGGGTGGAGGG + Intergenic
1056467551 9:86872796-86872818 GGGACAGATAGGAAACTGGGGGG - Intergenic
1056489744 9:87093822-87093844 GGGGCCTATTGGAAGGTGGAGGG - Intergenic
1056776544 9:89516990-89517012 GGGACCTATTTGAGGGTGGAGGG - Intergenic
1057025655 9:91732500-91732522 GGGACCTGTAGAAAGGTGCACGG + Intronic
1057959754 9:99443281-99443303 GGGACCTATCAGAAGGTGAAAGG + Intergenic
1058169788 9:101666478-101666500 GGGGCCTATAGGAGGGTAGAGGG + Intronic
1058270138 9:102962091-102962113 GGGGCCTATCAGAAGGTGGAGGG - Intergenic
1058817138 9:108694725-108694747 GGGGCCTGTAGGGAGGTTGGGGG + Intergenic
1058990034 9:110246663-110246685 ACGACCTCTAGGATGGTGGGTGG + Intronic
1059511201 9:114849280-114849302 GGGGCCTATCGGAGGGTAGGGGG + Intergenic
1059681042 9:116586629-116586651 GGGCACTATAGGAAGGGGGAGGG + Intronic
1059803235 9:117772140-117772162 GGGGCCTGTAGGAGGGTGGGGGG + Intergenic
1060046679 9:120347027-120347049 GGGGCCTATGGGAGGGTGGAGGG - Intergenic
1185620583 X:1450882-1450904 GGGACCCATAGGGATGGGGGAGG - Intronic
1185718132 X:2359913-2359935 GAGGCCTATCAGAAGGTGGGAGG + Intronic
1185718838 X:2365786-2365808 GGGGCCTGTCGGGAGGTGGGGGG + Intronic
1185920035 X:4081294-4081316 GGGGCCTACTGGAGGGTGGGGGG - Intergenic
1185925019 X:4136321-4136343 GGGGCCTATTGAAAGGTGGTGGG - Intergenic
1185949245 X:4412781-4412803 GGGACCTAATGGAGGGTGGAGGG + Intergenic
1186009604 X:5114877-5114899 GGGGCCTATTGGAGGGTGGAGGG + Intergenic
1186173944 X:6905608-6905630 GGGACCTAGTGGAAGGTGACTGG - Intergenic
1186226041 X:7400171-7400193 GGGAGGTAGAGGCAGGTGGGTGG - Intergenic
1186609630 X:11126374-11126396 GGGGCCTATTGGAGGGTGGAGGG + Intergenic
1186877354 X:13829455-13829477 GGGACCTGTATGATGGTGGTGGG - Intronic
1186919191 X:14259405-14259427 GGGGCCTATCGGGGGGTGGGGGG - Intergenic
1186949904 X:14612813-14612835 GGGGCCTGTCGGAGGGTGGGGGG + Intronic
1187013726 X:15305927-15305949 GGGGCCTATTGGAGGGTGGAGGG - Intronic
1187584661 X:20646856-20646878 GGGACCTCTAGGCAGGTTGGTGG + Intergenic
1187654736 X:21458760-21458782 GGGGCCTATTGGAAGGTGGAGGG - Intronic
1188116393 X:26249594-26249616 GGGGCCTGTCGGGAGGTGGGGGG + Intergenic
1188139190 X:26527489-26527511 GGGGCCTATTGGAGGGTGGAGGG - Intergenic
1188163927 X:26838040-26838062 GGGGCTTATTGGAAGGTGGAAGG - Intergenic
1188318070 X:28700705-28700727 GGGGCCTGTCGGAGGGTGGGAGG - Intronic
1188677076 X:32954694-32954716 GGGACCTGTTGGAGGGTGGAGGG - Intronic
1188850302 X:35123880-35123902 GGGGCCTATTGGAGGGTGGAGGG + Intergenic
1189148479 X:38679963-38679985 GGGGCCTATAGGAGGGTAGAGGG + Intronic
1189215140 X:39316545-39316567 GGGGCCTATCGGGGGGTGGGGGG + Intergenic
1190460995 X:50675161-50675183 GGGGCCTTTTGGAAGGTGGAGGG + Intronic
1190555399 X:51629092-51629114 GGGACCTCTCGTAGGGTGGGGGG + Intergenic
1191001524 X:55664570-55664592 GGGACCTGTCGGGAGGTCGGGGG - Intergenic
1191796181 X:65024095-65024117 GGGGCCTATCGGCGGGTGGGGGG + Intronic
1191944659 X:66518944-66518966 GGAGACTATTGGAAGGTGGGAGG - Intergenic
1192233913 X:69284353-69284375 GGGGTCTACAGGAAGGTTGGGGG + Intergenic
1192271162 X:69580865-69580887 GGGACCTGTCGGGGGGTGGGGGG + Intergenic
1192296440 X:69854160-69854182 GGGGCCTGTCGGAAGGTGGAGGG - Intronic
1192508186 X:71703589-71703611 GGGGCCTATTGGACGGTGGAGGG - Intergenic
1192518510 X:71777964-71777986 GGGGCCTATTGGACGGTGGAGGG + Intergenic
1192725323 X:73745019-73745041 GGGGTCTGTTGGAAGGTGGGAGG - Intergenic
1192770971 X:74190058-74190080 GGGGCCTGTCAGAAGGTGGGGGG + Intergenic
1193003798 X:76592655-76592677 GGGGCCTGTTGGAGGGTGGGGGG - Intergenic
1193263974 X:79445766-79445788 GGGACCTACTTGAAGGTGGAGGG + Intergenic
1193308702 X:79979750-79979772 GGGGCCTATGGGAGGGTGGAAGG - Intergenic
1193807114 X:86008246-86008268 GGGGCCTGTCGGCAGGTGGGGGG + Intronic
1194110663 X:89829685-89829707 GGGGCCTATTGGAGGGTGGAGGG + Intergenic
1194172564 X:90605647-90605669 GGGGCCTATCGGAGGGTGGAAGG - Intergenic
1194434266 X:93850261-93850283 GGGGCCTATTGGAGGGTGGAGGG + Intergenic
1194551162 X:95301238-95301260 GGGACCTATTGGGGGGTGGTGGG + Intergenic
1194559406 X:95402591-95402613 GGGGCCTATCAGAAGGTGGAAGG + Intergenic
1194958521 X:100208959-100208981 GGGGCCTGTTGGGAGGTGGGAGG - Intergenic
1195247764 X:103011121-103011143 GGGGCCTGTTGGAGGGTGGGGGG - Intergenic
1195429338 X:104770894-104770916 GGGGCCTATTGGAAGGTGGAAGG - Intronic
1196232216 X:113237502-113237524 GGGGCCTGTTGGGAGGTGGGGGG - Intergenic
1196253502 X:113488744-113488766 GGGACCTAAAGGAAGGTGTTTGG - Intergenic
1196332216 X:114485696-114485718 GGGGCCTGTCGGAGGGTGGGCGG - Intergenic
1196504430 X:116424695-116424717 GGGTCCTATAGGGGGTTGGGGGG + Intergenic
1196591971 X:117496050-117496072 GGGACCTATTGGAAGATGGAGGG + Intergenic
1196721626 X:118859752-118859774 GGGGCCTGGAGGAAGGTGGTTGG + Intergenic
1197136761 X:123069718-123069740 GGCACCTATGGGAGGGTGGAGGG + Intergenic
1197761407 X:130030876-130030898 GGGAGAGAAAGGAAGGTGGGAGG - Intronic
1197861692 X:130977932-130977954 GGGGCCTAGAGGGAGGTGTGTGG + Intergenic
1197906824 X:131434241-131434263 GGGACCTGTTGGAAGGTGGGGGG + Intergenic
1197907821 X:131445085-131445107 TGGGCCTATAGGAGGGTGGAGGG + Intergenic
1198105386 X:133456505-133456527 GGGGCCTGTCGGGAGGTGGGGGG - Intergenic
1198107103 X:133472411-133472433 GGGATCTATAGGAAGCAAGGAGG + Intergenic
1198426899 X:136529639-136529661 GGGACCTACTTGAAGGTGGAAGG + Intergenic
1198632768 X:138659897-138659919 GGGGCCTGTTGGCAGGTGGGGGG + Intronic
1198943473 X:141983885-141983907 GGGGCCTATTGGAGGGTCGGAGG + Intergenic
1199066489 X:143425081-143425103 GGGGCCTATTGGAGGGTGGAGGG - Intergenic
1199224515 X:145356860-145356882 GGGACCTATCAGAGGGTGGAGGG - Intergenic
1199557018 X:149120610-149120632 GGGACCTGGAGGAAGGAGGAGGG - Intergenic
1199720545 X:150540163-150540185 GGGACCTAGTGGAAGGTGTTTGG + Intergenic
1199771733 X:150979531-150979553 GGGAACTGTGGGAGGGTGGGTGG + Intergenic
1199806646 X:151306831-151306853 GGGACCTAGTGGGAGGTGGTTGG - Intergenic
1199902290 X:152188072-152188094 GGGGCCTTTGGGAAGGTGGGGGG + Intronic
1200463323 Y:3484427-3484449 GGGGCCTATTGGAGGGTGGAGGG + Intergenic
1200518791 Y:4183384-4183406 GGGGCCTATCGGAGGGTGGAAGG - Intergenic
1200604868 Y:5250601-5250623 GGGGCCTACTGGAAGGTGGAGGG + Intronic
1200948784 Y:8871660-8871682 GGGACCTATTGTAGGGTTGGGGG - Intergenic
1201409632 Y:13686400-13686422 GGGACCTGTTGGAGGGTGGAGGG + Intergenic
1201580665 Y:15508751-15508773 GGGGCCTCTTGGGAGGTGGGGGG + Intergenic
1201595997 Y:15669917-15669939 GGGAGGTAGAGGCAGGTGGGTGG - Intergenic
1201670992 Y:16519920-16519942 GTGGCCTACTGGAAGGTGGGAGG - Intergenic