ID: 1010380279

View in Genome Browser
Species Human (GRCh38)
Location 6:75216014-75216036
Sequence ACGTCTCCCTAGCAGTTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010380279_1010380285 21 Left 1010380279 6:75216014-75216036 CCATCTAACTGCTAGGGAGACGT No data
Right 1010380285 6:75216058-75216080 TGTGCCCATCTAAAAATCTAAGG No data
1010380279_1010380281 -9 Left 1010380279 6:75216014-75216036 CCATCTAACTGCTAGGGAGACGT No data
Right 1010380281 6:75216028-75216050 GGGAGACGTCTGGAAATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010380279 Original CRISPR ACGTCTCCCTAGCAGTTAGA TGG (reversed) Intergenic
No off target data available for this crispr