ID: 1010382093

View in Genome Browser
Species Human (GRCh38)
Location 6:75236998-75237020
Sequence ATGGATGCACAACAGGACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010382089_1010382093 9 Left 1010382089 6:75236966-75236988 CCTGAAGTGGTTCACAAGATGCT No data
Right 1010382093 6:75236998-75237020 ATGGATGCACAACAGGACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010382093 Original CRISPR ATGGATGCACAACAGGACCC AGG Intergenic
No off target data available for this crispr