ID: 1010385647

View in Genome Browser
Species Human (GRCh38)
Location 6:75276635-75276657
Sequence CTGGTAAATAAGAGTAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 208}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010385647_1010385650 -2 Left 1010385647 6:75276635-75276657 CCTGCTTTACTCTTATTTACCAG 0: 1
1: 0
2: 0
3: 18
4: 208
Right 1010385650 6:75276656-75276678 AGGCAATATTCTCCATGTCAAGG 0: 1
1: 0
2: 0
3: 9
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010385647 Original CRISPR CTGGTAAATAAGAGTAAAGC AGG (reversed) Intronic
902657920 1:17882158-17882180 CTGGTATATAAAAGTAATCCTGG + Intergenic
902843466 1:19090788-19090810 TTGGTAACTAAGAATAAATCTGG + Intronic
903356204 1:22749365-22749387 CTGGAAAAAAAGAGGAATGCAGG + Intronic
905962677 1:42058023-42058045 CTGTTAAATAATAGTTTAGCTGG - Intergenic
907595936 1:55719906-55719928 CTGGGAAAGAAAAGTAAATCGGG - Intergenic
909029189 1:70519131-70519153 CTGGTAAATAACATTCCAGCAGG - Intergenic
909092152 1:71239560-71239582 CTGGTACAACAGAATAAAGCAGG - Intergenic
909343414 1:74557117-74557139 CTGGGCAAGAAGAATAAAGCTGG + Intergenic
910306793 1:85773311-85773333 CTGGGCAAGAAGAATAAAGCTGG - Intronic
910955644 1:92701226-92701248 CTGGTAGATAAAAGCAAAGTAGG - Intronic
911884528 1:103280826-103280848 CTGGGCAAGAAGAGCAAAGCTGG - Intergenic
912696499 1:111846171-111846193 TTGGTCAATAAGTGTAAACCAGG + Intronic
912793090 1:112672809-112672831 TTGGTAAATATGAACAAAGCTGG + Intergenic
912968704 1:114260264-114260286 GTGGCAAACAAGAGTATAGCAGG - Intergenic
915898946 1:159832853-159832875 CTGGGAAAGAAAAGTACAGCTGG - Intronic
918365361 1:183802378-183802400 TTGAAAAAGAAGAGTAAAGCTGG - Intronic
919415114 1:197298293-197298315 CTGGTTAATAGGAGGAAAACAGG + Intronic
921458723 1:215403809-215403831 CTGGTAAAGAAGAGAAAATTAGG - Intergenic
1063136352 10:3219539-3219561 CTGGTAAACCTCAGTAAAGCTGG - Intergenic
1065733432 10:28730026-28730048 GTGGTAAATAAGAGTTGATCTGG + Intergenic
1066183276 10:32984092-32984114 GTGGTAATTAAGAGAAAACCTGG - Intronic
1070738395 10:78882743-78882765 AAGGAAAAAAAGAGTAAAGCGGG + Intergenic
1071057645 10:81529757-81529779 CAGTTTAATAAGAATAAAGCTGG - Intergenic
1071170711 10:82860444-82860466 CTGGTAGCTAAGAGCCAAGCCGG + Intronic
1071822424 10:89291964-89291986 CTGGAAATTGAGAGTAAAGAGGG - Intronic
1072711622 10:97719197-97719219 CTGCTAAAATAGAGTAGAGCAGG - Intergenic
1078846464 11:15123148-15123170 CTGAGAACTGAGAGTAAAGCAGG - Intronic
1079664378 11:23085087-23085109 TTGGTAATTAAGAGTGCAGCAGG + Intergenic
1082960147 11:58912180-58912202 CTGGTAAATGAAGGTACAGCAGG + Intronic
1083286414 11:61662008-61662030 CTGATTAATAAGAGAAAAGGCGG - Intergenic
1083760480 11:64813970-64813992 CTGGTTAATAAGAGAATTGCGGG + Intergenic
1088463661 11:110110406-110110428 CTGGTAAAAAAGAGTACAGTGGG - Intronic
1090680332 11:129048994-129049016 CTGGTAAGTGAGAATAAAGTCGG + Intronic
1093360048 12:18213962-18213984 CTGACAAATAAGAGCAAAGCTGG + Intronic
1095212214 12:39507527-39507549 CTGGTACAGAATAGTAAGGCAGG - Intergenic
1095560511 12:43559696-43559718 TTGTTAAGCAAGAGTAAAGCAGG + Intergenic
1098765119 12:74478342-74478364 CTGGTAAATATGAGCCAGGCAGG - Intergenic
1099198114 12:79643022-79643044 TTGGTATATAAGAATATAGCAGG - Intronic
1099345085 12:81489543-81489565 ATGGTAACTAAGAGAAAAGTAGG - Intronic
1101228691 12:102716495-102716517 TTGATAAACAAGAATAAAGCTGG - Intergenic
1101600822 12:106208223-106208245 CTGGGCAAGAAGAATAAAGCTGG - Intergenic
1103150157 12:118630800-118630822 CTGGTATATAAGAGTCTAGAAGG + Intergenic
1105617770 13:22035567-22035589 CTGGGAAATCAGAGTGAAGAAGG - Intergenic
1105686040 13:22782995-22783017 CTTGCAAATAAGAGCAAAGTGGG - Intergenic
1106398421 13:29404016-29404038 GTAGTAAATAAGAGTATAGATGG - Intronic
1107416967 13:40209926-40209948 CTGCTAAAAAAGAGAAAAGCTGG - Intergenic
1108906102 13:55476182-55476204 TTGGAAAGTAAGAGCAAAGCTGG - Intergenic
1109050769 13:57478484-57478506 CTGGTCAAGAAGAAAAAAGCTGG + Intergenic
1109452541 13:62536723-62536745 ATGGAAAATAGGAGAAAAGCAGG - Intergenic
1110497005 13:76179909-76179931 CTGGAAAAGAAGAGTAAAGTTGG + Intergenic
1111099387 13:83562767-83562789 ATAATAAATAAGAGTAGAGCTGG - Intergenic
1111683002 13:91467029-91467051 CTGGTAACTAAGATCAATGCAGG - Intronic
1112482682 13:99791605-99791627 CTGTAAAATAAGAGTAAGGATGG + Intronic
1112969491 13:105242468-105242490 TTTGAAAATAAGAATAAAGCAGG + Intergenic
1113780615 13:112974670-112974692 CTAGTAAATATGAGAGAAGCTGG + Intronic
1113919004 13:113895312-113895334 ATGGTAAATAAAAGAAAAACTGG - Intergenic
1115001959 14:28432929-28432951 TTGAAAAATAAGAATAAAGCTGG - Intergenic
1115153014 14:30307081-30307103 CTGGAAAATAAGAGTTCAACTGG + Intergenic
1116431579 14:44851962-44851984 TTAGGAAATAAGAATAAAGCTGG - Intergenic
1117475572 14:56091359-56091381 CAGGTAAATATGAGTAAATTAGG - Intergenic
1121822039 14:96978292-96978314 CTGGAAAAAAAGAGAAAAGAAGG - Intergenic
1122044026 14:99010702-99010724 CTGGGAAGTAAGATAAAAGCAGG + Intergenic
1123668687 15:22630585-22630607 TTGGTTAATACAAGTAAAGCAGG - Intergenic
1124420453 15:29516581-29516603 CTGGGAAATGAGAGCAAAGGAGG + Intronic
1124524664 15:30437062-30437084 TTGGTTAATACAAGTAAAGCAGG - Intergenic
1124773989 15:32570650-32570672 TTGGTTAATACAAGTAAAGCAGG + Intergenic
1127642223 15:60926666-60926688 CTCGTTTATAAGAGAAAAGCTGG + Intronic
1129529760 15:76255639-76255661 CTGGACAATAGAAGTAAAGCAGG - Intronic
1129586199 15:76868834-76868856 CTGGGCAAAAAGAATAAAGCTGG + Intronic
1129591594 15:76920012-76920034 CAGGTAAGAAAGAGTGAAGCAGG + Intergenic
1134327154 16:13217634-13217656 GTGCTAAATAAGAGTAAAAGAGG + Intronic
1135228275 16:20680715-20680737 CTGGTAAGTAGGAGTAATTCTGG - Intronic
1135832205 16:25785659-25785681 AGGGTGAATAAGAGTTAAGCAGG + Intronic
1138697034 16:58823977-58823999 CTGGCAAAGAAGAACAAAGCTGG - Intergenic
1140278505 16:73532559-73532581 CTGGTACATAAGAGGAGGGCTGG + Intergenic
1146760873 17:35476907-35476929 CTAGAAAATAAGAGAAAAACTGG + Intronic
1147636056 17:41964970-41964992 CTGAAAAATAAGAGAAAAGCGGG - Intronic
1148288400 17:46417544-46417566 CTGGTAATTAAGTGAAAAGTTGG + Intergenic
1148310568 17:46635129-46635151 CTGGTAATTAAGTGAAAAGTTGG + Intronic
1150465752 17:65391324-65391346 CTGGTGAATAATAATTAAGCTGG + Intergenic
1153027749 18:686861-686883 CTGGTACAGAAGAGAACAGCAGG - Intronic
1153619415 18:6962986-6963008 CTGGTACAGAAGAGTGCAGCTGG - Intronic
1154138590 18:11802753-11802775 GTGGGAAAGAAGAATAAAGCGGG + Intronic
1154296047 18:13149562-13149584 CTGATCAAAAAGAGCAAAGCAGG - Intergenic
1155940097 18:31794328-31794350 CTGGGAAACAAGTGAAAAGCTGG - Intergenic
1156526271 18:37770237-37770259 CTGTTAAATAAAAAGAAAGCAGG - Intergenic
1157136356 18:45060227-45060249 CTGATATATATGAGTAAAGCAGG + Intronic
1157903680 18:51545511-51545533 CTGGTAAGTAGGAGTTAATCAGG + Intergenic
1158720443 18:59919817-59919839 GTGGTGAAGAAGAATAAAGCAGG - Intergenic
1164108382 19:22130702-22130724 CTGGAAAATAAGGGCAAAACTGG - Intergenic
1165854645 19:38872011-38872033 GTGGTACACAAGAGTAAAGATGG - Intronic
1166022733 19:40047355-40047377 CAGGTAAGTGAGAGTAAAGCAGG - Exonic
1166025655 19:40081799-40081821 CAGGTAAGTGAGGGTAAAGCAGG - Exonic
925938177 2:8788090-8788112 TTGGTAAATAAAAGTTAAACAGG + Intronic
926161310 2:10491581-10491603 TTGGTAAAGAAGAGCAAAGTTGG + Intergenic
926247393 2:11131470-11131492 CTGGTAAAGATGAGCACAGCAGG - Intergenic
926928113 2:18008799-18008821 CTGGTATTCAAGAGGAAAGCAGG - Intronic
927331364 2:21867556-21867578 CTGATAAAAAAGAACAAAGCTGG + Intergenic
929247096 2:39714133-39714155 TTAGTAAGTAAGAGGAAAGCAGG - Intronic
929263758 2:39895497-39895519 TTGGTAAATATGAGGAAACCAGG - Intergenic
929480557 2:42303438-42303460 CTGGTAGATGTGAGTGAAGCAGG + Exonic
929767652 2:44860892-44860914 CAGGTAAACAAGAATAGAGCAGG + Intergenic
931803249 2:65779022-65779044 CTGGGATACAAGAGTAGAGCTGG + Intergenic
932200340 2:69821195-69821217 CTGGTAAAGAACAGTAATTCAGG - Intronic
932970416 2:76534278-76534300 ATGGATAATAAGAGTAAAACAGG - Intergenic
935151875 2:100444630-100444652 TTGATAAAGAAGAATAAAGCAGG - Intergenic
939358031 2:141129540-141129562 CTGTTAAATAACAGTAATGATGG - Intronic
940662563 2:156565400-156565422 CTGGTAAAATTGTGTAAAGCAGG + Intronic
940664792 2:156595048-156595070 CTGGAAAATGAGGGTAAAGATGG + Intronic
941391957 2:164925636-164925658 CTGGTAAATAACATAAAAGAAGG + Intronic
941731293 2:168921240-168921262 CTGGTATATAACAGCAAAGATGG - Intergenic
941778146 2:169415029-169415051 AGGGTAAATAATAATAAAGCTGG - Intergenic
942720704 2:178949228-178949250 CTGGTAGATAAGAATGAAGAAGG + Intronic
943080099 2:183249429-183249451 CTGCAAGACAAGAGTAAAGCTGG + Intergenic
943496039 2:188621907-188621929 CTGTTAAGTAATAGGAAAGCAGG + Intergenic
943650077 2:190448176-190448198 ATGGTAGACAAGAGTAAAGATGG + Intronic
943991356 2:194696978-194697000 CTAGTGAATATGATTAAAGCAGG - Intergenic
944579689 2:201121174-201121196 CTGGCAAATAATTATAAAGCTGG + Intronic
944885873 2:204062050-204062072 CTGGAAAATAACATTAAAACAGG + Intergenic
946644635 2:221819736-221819758 CTGGTAAATGAGGGTAAAACTGG + Intergenic
947557578 2:231109770-231109792 CTGGATAATAAGAAAAAAGCAGG - Intronic
947908243 2:233782164-233782186 CTGAGCAAAAAGAGTAAAGCTGG - Intronic
1168967408 20:1907217-1907239 CTGGTAAATAAGCTGACAGCTGG - Intronic
1173595350 20:44255599-44255621 CCAGCAAATAAGTGTAAAGCTGG + Intronic
1174846108 20:53944713-53944735 CTGGCAAATAACAGTAAAGATGG - Exonic
1176661543 21:9639930-9639952 TTAGAAAATAAGAGTCAAGCAGG + Intergenic
1177281200 21:18985138-18985160 CTGGCAAGTAAGACTAATGCTGG - Intergenic
1177968562 21:27759738-27759760 CTTGTAAATAAGTCTAAAGTAGG - Intergenic
951931328 3:27970411-27970433 GTGGGAAACAAGAGTAAAGGTGG + Intergenic
953502344 3:43449405-43449427 CTGGAAGATAAGAGAAAATCTGG - Intronic
953602570 3:44382168-44382190 CTGAAAAAGAAGAGCAAAGCTGG + Intronic
955589464 3:60519165-60519187 CTGGAAAATAAGATTATAGATGG + Intronic
956204020 3:66737540-66737562 CTGGTAAAAATGAGATAAGCTGG + Intergenic
957988455 3:87600331-87600353 TGGGTAAATAAGAGAAAAGCAGG + Intergenic
960136646 3:114112339-114112361 CTGGTTAATAAGATAAAAGGGGG + Intergenic
961939647 3:130623926-130623948 CTGGTAAAGAAAAGTTAAGGAGG + Intronic
962527102 3:136246728-136246750 CTGGTAAATAAGACTATCTCAGG + Intergenic
963812638 3:149794050-149794072 CTGGAAAAGAAGAGTAATGAGGG + Intronic
964830882 3:160883487-160883509 CTGGGAAACAATAGTAATGCAGG - Intronic
965248784 3:166313805-166313827 TTGGTAAATAAGATGAAAGCAGG + Intergenic
965763088 3:172101593-172101615 CTGTAAAATAAGTATAAAGCAGG - Intronic
966177151 3:177151151-177151173 GTGGTATATAAAAGCAAAGCTGG + Intronic
967199693 3:187061427-187061449 CTGAAAAATAAGAATAAAGCTGG + Intronic
968713654 4:2138709-2138731 CTGGCCAATAAGATGAAAGCTGG + Intronic
970120195 4:12745303-12745325 GTGGTCAAGAAGTGTAAAGCAGG - Intergenic
970496745 4:16633812-16633834 CTGGTCAAGAAGAACAAAGCCGG + Intronic
970503919 4:16707574-16707596 CTGGCAAATAAAAATGAAGCCGG - Intronic
970595155 4:17593532-17593554 CTGAAAAAGAAGAGCAAAGCTGG - Intronic
974263538 4:59555907-59555929 CTGGGCAAGAAGAGCAAAGCTGG - Intergenic
975065581 4:70059399-70059421 GTGCTAAAGAAGTGTAAAGCAGG + Intergenic
975501956 4:75096445-75096467 CTGGGAAAGAAGAACAAAGCTGG - Intergenic
977264928 4:94842470-94842492 CTTGTAAATAAAAGTGAATCAGG - Intronic
977794648 4:101148828-101148850 TTTGTTAAAAAGAGTAAAGCTGG + Intronic
978001628 4:103561358-103561380 TTGTAAAAGAAGAGTAAAGCTGG + Intergenic
978236478 4:106466998-106467020 CTGGTCAAGAAGAACAAAGCTGG - Intergenic
980028085 4:127790509-127790531 CAGGAAAATAAGGGTATAGCAGG - Intronic
981342365 4:143636248-143636270 CTGGGAAATGAGAGTAAAGAGGG + Intronic
983289831 4:165787862-165787884 CTTATAAATAAGAGTGAAGATGG + Intergenic
985413852 4:189716617-189716639 TTAGAAAATAAGAGTCAAGCAGG - Intergenic
986898433 5:12400369-12400391 CTTGTAAAGAAGAGGAAATCAGG + Intergenic
994382325 5:99085826-99085848 GTGGTAAATGAGAGGCAAGCCGG + Intergenic
995638173 5:114219568-114219590 CTGGTAGATGAGATTACAGCTGG - Intergenic
997178586 5:131804387-131804409 TTAGAAAATAAGAGTAGAGCAGG + Intergenic
998596193 5:143533082-143533104 CTTGTAAATAAGAGGATAGGTGG + Intergenic
998620322 5:143787567-143787589 TTAGTAAATAATAGTAAAGATGG + Intergenic
998656609 5:144188279-144188301 CTGCTAAATAACAGTAAATCTGG - Intronic
1000846222 5:166284004-166284026 CTGGAAAAGAAAAGTAAAACTGG + Intergenic
1002653038 5:180717777-180717799 CTGGTAGAAAAGAGGAAAGAGGG - Intergenic
1003007701 6:2397198-2397220 CTGGTAAACAAGAGAAAAAAAGG - Intergenic
1004113209 6:12741683-12741705 TTGACAAATAAGAGTAAAGTTGG - Intronic
1005713653 6:28526189-28526211 CTGGCAAAGAAGAAGAAAGCAGG - Intronic
1010385647 6:75276635-75276657 CTGGTAAATAAGAGTAAAGCAGG - Intronic
1010537640 6:77050684-77050706 CTGGGCAAGAAGAATAAAGCTGG + Intergenic
1011610703 6:89147282-89147304 CTGGAAAAGCAGAGTAAAACAGG - Intronic
1012127104 6:95443956-95443978 TTGTTAAATAAGTGCAAAGCAGG + Intergenic
1012702028 6:102470732-102470754 TTGATAAATAAGAATAAAGTTGG - Intergenic
1014727709 6:124992369-124992391 TTGATAAATAATAGTCAAGCAGG + Intronic
1016393144 6:143594825-143594847 CTGGTTAATGAGAGCAAAACAGG - Intronic
1016929179 6:149385938-149385960 CAGTTAAATAAGGGAAAAGCTGG - Intronic
1016985632 6:149893142-149893164 CTGGGCAAGAAGAGCAAAGCTGG - Intronic
1018674290 6:166205672-166205694 CAGATAAACAAGAGAAAAGCAGG + Intergenic
1021224140 7:18008377-18008399 CTGGGAAAGAAGAACAAAGCTGG - Intergenic
1022013993 7:26333013-26333035 CTGAAAAAGAAGAATAAAGCAGG - Intronic
1022201792 7:28124166-28124188 CTGATTAATAAGAGGAGAGCAGG + Intronic
1022322856 7:29303475-29303497 CTGGGAAATAAGAGGGAAGGGGG - Intronic
1023618633 7:42047210-42047232 CTGGTTAATAATAGTAATACAGG - Intronic
1024236697 7:47404002-47404024 CAGGTAAATAAAGTTAAAGCCGG - Intronic
1025092302 7:56074252-56074274 CTGGAGAATAAGAGTCAAGCAGG - Intronic
1028627529 7:92894169-92894191 CTGGGCAAGAAGAGCAAAGCTGG - Intergenic
1032412951 7:131712651-131712673 CTGGAAAAGAAGAGCAAAGTTGG - Intergenic
1034238624 7:149592334-149592356 TTGTTAAATTAGAGTAAAGAGGG - Intergenic
1035150351 7:156865628-156865650 GTGGAAAAAAAGAGCAAAGCTGG + Intronic
1035465704 7:159075149-159075171 CTGTTAAATAAGAATAAAAATGG + Intronic
1037223460 8:16554336-16554358 CTGACAAATAAGAGGAAAACTGG + Intronic
1037555628 8:20019336-20019358 GTGGTAAATAAAAGAAAAACAGG + Intergenic
1039644172 8:39262486-39262508 CTGAGAAAAAAGAGTAAAGCTGG - Intronic
1040456887 8:47606987-47607009 GTGGTACATAAAAGAAAAGCAGG - Intronic
1041248718 8:55914158-55914180 ATGGGAAATAAGAGAAAGGCAGG + Intronic
1042485857 8:69345003-69345025 CTGTTAAATGACAATAAAGCAGG - Intergenic
1043419004 8:80080010-80080032 CTGGTAAATAACAAAAAAGGAGG - Intronic
1043779712 8:84316138-84316160 CTGGGAAATCAGAGTAAAGATGG - Intronic
1044846865 8:96390445-96390467 CAGGTAGAGAAAAGTAAAGCTGG - Intergenic
1044847611 8:96397704-96397726 CTAATAAATAAGAGTAACGTGGG + Intergenic
1045975922 8:108130927-108130949 TTGGTAAATAAGTGTAAAAAAGG - Intergenic
1046388664 8:113538647-113538669 ATACTAAATAAGAATAAAGCTGG - Intergenic
1047108268 8:121759279-121759301 ATGTCAAATAAGAATAAAGCAGG + Intergenic
1047604540 8:126461952-126461974 CTGGGCAAGAAGAATAAAGCTGG + Intergenic
1048778289 8:137972106-137972128 CTGGTAATTAAAGGTCAAGCAGG - Intergenic
1052120420 9:24708703-24708725 CTGGTAAAGAACTGTAAACCAGG - Intergenic
1052476627 9:28969380-28969402 CTGGTAACTGAGACTGAAGCAGG + Intergenic
1053032304 9:34791274-34791296 CTGGTGTATAAGAGAAAAGAGGG + Intergenic
1055471305 9:76614025-76614047 CTGGTAAACAAGAACAAAACGGG + Exonic
1060111820 9:120911893-120911915 CTGGTATGTAAAAGTAGAGCTGG + Intronic
1060879311 9:127106843-127106865 GTGTGAAATAAGTGTAAAGCAGG + Intronic
1203639106 Un_KI270750v1:141773-141795 TTAGAAAATAAGAGTCAAGCAGG + Intergenic
1185951630 X:4441685-4441707 CTTGTAGATAAGAGTATACCTGG - Intergenic
1186100628 X:6152383-6152405 CTGGTAAACAATAGCAAAACTGG - Intronic
1187549130 X:20283608-20283630 CTGGTAAATAAGATTAATTTGGG - Intergenic
1188666247 X:32824761-32824783 CACATAAATATGAGTAAAGCTGG + Intronic
1188945949 X:36301865-36301887 CTGGTAAATAGGGGTAAACAAGG + Intronic
1189674170 X:43443926-43443948 CTGGAAAATATGAGCAAAGGTGG + Intergenic
1195007436 X:100699793-100699815 TTGGTTATTAAGAGTAATGCTGG - Intronic
1195810791 X:108826455-108826477 CTTGAAAAGAAGAGTAAAGTGGG + Intergenic
1197418170 X:126202483-126202505 TTGGTAAATAAGAGAATAGGAGG + Intergenic
1198882538 X:141296444-141296466 CTGAGAAAAAAGAGTAAAACTGG + Intergenic
1198948836 X:142046206-142046228 CTGGTAAATAAGAATAGAGAGGG - Intergenic
1200584719 Y:4994385-4994407 CAGAAAAATAAGAGTAAAGTAGG + Intergenic