ID: 1010386273

View in Genome Browser
Species Human (GRCh38)
Location 6:75284445-75284467
Sequence GGTCTCATCTTCATTCCCAT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 125}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010386273_1010386276 17 Left 1010386273 6:75284445-75284467 CCGATGGGAATGAAGATGAGACC 0: 1
1: 0
2: 1
3: 10
4: 125
Right 1010386276 6:75284485-75284507 GTAGCACCGTGCCAGCCGTAAGG 0: 1
1: 0
2: 0
3: 2
4: 36
1010386273_1010386274 -5 Left 1010386273 6:75284445-75284467 CCGATGGGAATGAAGATGAGACC 0: 1
1: 0
2: 1
3: 10
4: 125
Right 1010386274 6:75284463-75284485 AGACCGATGATGAAGAAAATAGG 0: 1
1: 0
2: 1
3: 14
4: 198
1010386273_1010386278 22 Left 1010386273 6:75284445-75284467 CCGATGGGAATGAAGATGAGACC 0: 1
1: 0
2: 1
3: 10
4: 125
Right 1010386278 6:75284490-75284512 ACCGTGCCAGCCGTAAGGATGGG 0: 1
1: 0
2: 0
3: 1
4: 20
1010386273_1010386277 21 Left 1010386273 6:75284445-75284467 CCGATGGGAATGAAGATGAGACC 0: 1
1: 0
2: 1
3: 10
4: 125
Right 1010386277 6:75284489-75284511 CACCGTGCCAGCCGTAAGGATGG 0: 1
1: 0
2: 0
3: 7
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010386273 Original CRISPR GGTCTCATCTTCATTCCCAT CGG (reversed) Exonic
901370845 1:8796155-8796177 GATCTCATCTTGATTCAAATGGG + Intronic
905231843 1:36519294-36519316 GGTCTCAACTTCCTTCCCTGGGG + Intergenic
913522322 1:119656633-119656655 AGTCTCAGTTTCATTTCCATTGG + Intergenic
918115270 1:181490762-181490784 GGTGTCATCTTTCTTCCCTTTGG + Intronic
922867008 1:228868825-228868847 GGTCTCATTCTGATTCCCCTGGG + Intergenic
924028034 1:239858056-239858078 TGTCTCATCATAATTCTCATTGG + Intronic
1065156345 10:22873855-22873877 TGTCTCATGTTTATTCGCATAGG + Intergenic
1067167405 10:43876668-43876690 AGACTAATCTTCATTTCCATGGG - Intergenic
1068626297 10:59252113-59252135 GGTCTTATTTTCATTCACAAGGG - Intronic
1069170743 10:65225793-65225815 GGTGTCCTCTACATTCCAATGGG + Intergenic
1071675825 10:87655122-87655144 GTTCTCTTCTTCATGCCCTTCGG - Intergenic
1073065048 10:100753335-100753357 GCTCTCATCTTCATCCCTGTAGG + Intronic
1074574676 10:114657305-114657327 GGTATCATCTTCATTAACAAAGG + Intronic
1076865204 10:133163191-133163213 CGTCTCATCTGAATTCCCATGGG - Intronic
1078150642 11:8756826-8756848 AGTCTCTGCTCCATTCCCATGGG - Intronic
1079943776 11:26715807-26715829 TGTCTCATTTGCATTCCCCTAGG + Intronic
1087478256 11:98665319-98665341 GGTGTCATCTTCAGGCCCATGGG + Intergenic
1088425126 11:109693773-109693795 AGGCTCATCTTTATGCCCATGGG - Intergenic
1090260219 11:125314113-125314135 GGTCTCCTCTGCATACCCACAGG - Intronic
1092195739 12:6548715-6548737 GCTCTCCTCCTCATCCCCATCGG + Exonic
1095570151 12:43675306-43675328 AGTCTCATCTTCATACCCCTAGG - Intergenic
1097841977 12:64330318-64330340 GGTCCTATTTTCAATCCCATGGG + Intronic
1097924302 12:65110647-65110669 GGTCTCATTATGATTCCCTTTGG - Intronic
1097931407 12:65190872-65190894 TGTTTCATCTTCATTCACAAAGG + Intronic
1098464534 12:70771352-70771374 GCTCTCATCTTTATGTCCATGGG - Intronic
1100107886 12:91199567-91199589 TATCTCTTCTTTATTCCCATTGG + Intergenic
1100498852 12:95153705-95153727 GTTCTCATCTACATTCCTATTGG - Intronic
1101889096 12:108696070-108696092 GATCTCTTCTTCTCTCCCATGGG - Intronic
1106342733 13:28846747-28846769 GGACTCATCTTCCTTCTCAAAGG + Intronic
1113498468 13:110753746-110753768 GACCTCTTCTTCATTCCCCTTGG + Intergenic
1117064291 14:51994513-51994535 TGTTGTATCTTCATTCCCATTGG + Intronic
1117249804 14:53925546-53925568 GCTCTCATTATCATTCCCAAAGG + Intergenic
1117647882 14:57871250-57871272 GGTCTGATCTTCAGTCCACTGGG - Intronic
1120169979 14:81238412-81238434 CGTCTCATCTTCAAACCCAGAGG + Intergenic
1120246375 14:82011482-82011504 GACCTCATCTCCATTCCCCTGGG - Intergenic
1120321484 14:82967427-82967449 GGTCTCATTTTCACTCCATTTGG - Intergenic
1124822705 15:33063235-33063257 TCCCTCATCGTCATTCCCATTGG - Intronic
1125694022 15:41620779-41620801 GGTCTCATCTTCTATCCCAAGGG + Intergenic
1125920418 15:43522168-43522190 GATCTCAGCCTCCTTCCCATTGG - Exonic
1128092102 15:64926185-64926207 GGGCTACTCATCATTCCCATTGG + Intronic
1134667748 16:16031441-16031463 GGGCTCATCTTCATTTCTCTGGG + Intronic
1137491433 16:48936449-48936471 TTTCTCATTTTCATCCCCATGGG + Intergenic
1137516036 16:49145221-49145243 GGTCTGTTCTCCATTGCCATAGG - Intergenic
1137861832 16:51854695-51854717 GATGTCCTCTTCATTCCCCTAGG - Intergenic
1141689821 16:85590008-85590030 CGTCTCATGTTCATTCACACAGG - Intergenic
1143577621 17:7803856-7803878 GGGCCCACATTCATTCCCATAGG + Intronic
1143953689 17:10653086-10653108 GGTGTCTTCTTCCTCCCCATTGG + Intronic
1144154197 17:12482598-12482620 GGCATCACCTTCATTCTCATTGG + Intergenic
1144937059 17:18908310-18908332 GGACTCATCTGCATTCTCAGTGG - Intronic
1153146133 18:2034664-2034686 GCTCTCATCCCCATTCCCAGGGG - Intergenic
1153637395 18:7124733-7124755 GATATCATCTTCATCACCATGGG + Intergenic
1155218090 18:23661196-23661218 GCAATCATGTTCATTCCCATGGG + Intronic
1157584017 18:48790012-48790034 GATCACAGCTTCATTGCCATGGG + Intronic
1158316089 18:56212711-56212733 GCACTCAACTTCATTCCCACTGG + Intergenic
1162401569 19:10449900-10449922 GGTCTCATTTTGTTTCCCCTGGG - Intronic
1162882862 19:13673136-13673158 AGTCTCTTCCTCCTTCCCATTGG + Intergenic
1162956343 19:14100736-14100758 GGACTCCTCTGCATTCCCAGGGG + Intronic
1163008591 19:14411172-14411194 GGTTTCCTCCTCATCCCCATAGG - Exonic
1163023591 19:14496426-14496448 GGCCCCAGCTTCCTTCCCATTGG - Intergenic
1163578697 19:18125218-18125240 GGTCTCAGCATAATTCCCACAGG - Intronic
1166260136 19:41633349-41633371 GGTCTAGTCTTCATTTGCATAGG - Intronic
925572480 2:5326441-5326463 GGTCTGATCCTCCTGCCCATGGG - Intergenic
930501194 2:52220614-52220636 GGCCAAATCTTCATTCACATAGG - Intergenic
939441876 2:142260551-142260573 GATCTCAACTTGATTCCCCTGGG + Intergenic
939827582 2:147033540-147033562 AGTCTAATCTTCTTTCCCTTGGG - Intergenic
941515272 2:166465818-166465840 GGTTTCATTTTCATTCTCTTGGG + Exonic
943988465 2:194654918-194654940 GTTCTTATTTTCTTTCCCATGGG - Intergenic
944455906 2:199893847-199893869 GATCTCATTTTCTTTCCCCTGGG + Intergenic
944694226 2:202186761-202186783 TTTCTCATCTTCCTTACCATGGG + Intronic
945191404 2:207191724-207191746 GGCCACATTTTCATTTCCATAGG - Intergenic
948550133 2:238765633-238765655 GGTCTCACCTCCATTCCCCGGGG + Intergenic
1168737088 20:149821-149843 GGTCTCAACTTCAATCCCTAGGG + Intergenic
1170800914 20:19589592-19589614 GGTCTCATCTTCAGCTCCCTTGG + Intronic
1170874481 20:20237342-20237364 GGTCGCATCCTCATTCCTACAGG + Intronic
1172316883 20:33962401-33962423 GGTCTTTTCTTCATTCTTATCGG + Intergenic
1172331398 20:34078349-34078371 GGTCCCATAGTCATTCCCCTTGG + Intronic
1172759352 20:37311183-37311205 GTTCTCATCTTCATTCCCCGTGG + Intronic
1173378645 20:42515041-42515063 GGTTTTATCTTAATTGCCATCGG + Intronic
1175548843 20:59802535-59802557 GGTCCCATCTTCCATCCCAGTGG - Intronic
1176360676 21:5994768-5994790 GGTCTCATTTTCCTTGCAATGGG + Intergenic
1179515334 21:41902683-41902705 GGTCTTATCTTGACTCCCTTTGG - Intronic
1179762842 21:43543782-43543804 GGTCTCATTTTCCTTGCAATGGG - Intronic
951737674 3:25885732-25885754 TGACTCACCATCATTCCCATCGG - Intergenic
953243884 3:41173668-41173690 GGCCTCCTCGTCATACCCATTGG - Intergenic
955987150 3:64585420-64585442 GCTGTCTTATTCATTCCCATTGG - Intronic
956237544 3:67090985-67091007 GATGTAAGCTTCATTCCCATGGG - Intergenic
960058892 3:113298373-113298395 GCTCTCCTCTTCTTCCCCATTGG + Intronic
961513624 3:127419695-127419717 GGCCTTATCCTCTTTCCCATGGG + Intergenic
962897890 3:139732235-139732257 GTTCTCATCTCCCTCCCCATTGG - Intergenic
964264426 3:154877905-154877927 CGTTTTATCTTCGTTCCCATTGG - Intergenic
967139344 3:186541090-186541112 TTTCTCATCATCATTCACATTGG - Intronic
970548674 4:17156597-17156619 GGTCTCTTTTGCATACCCATTGG - Intergenic
972574753 4:40341511-40341533 GGTCACATCTTCATTTGCATAGG + Intronic
975197328 4:71541118-71541140 GCTCTCATCTCCACTCCCAAGGG - Intronic
977299569 4:95252796-95252818 GGTGTCACCGTCATTCCCTTGGG - Intronic
981866837 4:149431676-149431698 GGCCTGATCTTTGTTCCCATAGG + Intergenic
988870663 5:35385440-35385462 GGATTCATCCTCATTCACATGGG - Intergenic
989192879 5:38688582-38688604 TAGCTCATTTTCATTCCCATTGG + Intergenic
994354449 5:98779558-98779580 GGTCTTATCTTCTTTCCCATAGG + Exonic
996109608 5:119549876-119549898 TGTGCCATCTTCATTTCCATAGG + Intronic
996243616 5:121232678-121232700 GGTCTAGTCTTCATTTGCATAGG - Intergenic
996437995 5:123457097-123457119 GTTCTCATCTCCATTAACATTGG - Intergenic
1001032183 5:168271083-168271105 GGTCTCTTTGACATTCCCATGGG - Intergenic
1003014057 6:2453741-2453763 GGTTTCATCTGCATTTCCCTAGG + Intergenic
1007969661 6:46037961-46037983 GGTCTCATCCTCTTTCCCTGAGG - Intronic
1008246665 6:49183107-49183129 GGTCTCATTTTCATTTCCCCTGG - Intergenic
1010386273 6:75284445-75284467 GGTCTCATCTTCATTCCCATCGG - Exonic
1011125022 6:83998009-83998031 GGATTCCTGTTCATTCCCATGGG - Intergenic
1013386277 6:109634920-109634942 TCTCTCAACTTCATGCCCATGGG + Intronic
1018275511 6:162126214-162126236 GTTCTCATTCTCATTCCCAATGG + Intronic
1019543593 7:1562231-1562253 TGTCTCTGGTTCATTCCCATCGG + Intergenic
1020538876 7:9436142-9436164 AGCCTCTTCTTCATTTCCATTGG + Intergenic
1020584509 7:10049438-10049460 GGACTCTGCTTCATTCACATAGG + Intergenic
1024597047 7:50947104-50947126 GGTTTCAGCTTGAGTCCCATGGG - Intergenic
1028037476 7:86003199-86003221 GGGCCCATCTTCATTCCTCTAGG + Intergenic
1028562511 7:92191100-92191122 GGTCTCAATTTCATTCCATTTGG + Intergenic
1033594026 7:142841575-142841597 AGTCATATCTTCATTCCCAGAGG - Intergenic
1035658458 8:1329623-1329645 GGGCCCATGTTCATTCCCCTCGG - Intergenic
1037896567 8:22660352-22660374 GGCCTCATCTCCATTCCGATGGG + Intronic
1038112545 8:24515465-24515487 AGCCTCCTCTTCATTCCCCTGGG - Intronic
1039690485 8:39859422-39859444 TGTCTCCTTTTCTTTCCCATAGG - Intergenic
1043592016 8:81843558-81843580 GGCCTAGTCTTCATTTCCATAGG - Intergenic
1043755687 8:84000693-84000715 GCTCTCATCTCCATACCCCTGGG + Intergenic
1050491323 9:6191000-6191022 TGTCTCCTCTTCATTCTCCTTGG - Intergenic
1055434911 9:76282802-76282824 GTTCTCGTCTTCATGTCCATGGG + Intronic
1055604684 9:77956515-77956537 GGATTCATGTTCCTTCCCATAGG - Intronic
1057581633 9:96292262-96292284 GGTCTAATATTCATGTCCATTGG + Intronic
1058163967 9:101599733-101599755 GGTCTCATTTCCATTTCCGTTGG - Intronic
1058463537 9:105206166-105206188 GGCCTCATCTTGCCTCCCATGGG - Intergenic
1060566760 9:124599518-124599540 GGACTCGTCTTCATTCTCAATGG + Intronic
1193458620 X:81761847-81761869 TGTCACTTCTTCTTTCCCATAGG - Intergenic
1194696071 X:97052634-97052656 CTTCTCATCTTCATTCCCAAAGG - Intronic
1195717522 X:107831252-107831274 TGTCTCAGCTTCCTTCCCGTAGG + Intronic
1196351336 X:114734209-114734231 CGTCTCATCTTCATTCTCTTTGG - Intronic
1199539007 X:148937058-148937080 GGTCTCCTCTCCTATCCCATAGG - Intronic
1200853957 Y:7917301-7917323 TGGCTCATATTCCTTCCCATGGG - Intergenic
1200891700 Y:8330927-8330949 GGGCTCATATTCCTTTCCATGGG + Intergenic