ID: 1010387415

View in Genome Browser
Species Human (GRCh38)
Location 6:75297880-75297902
Sequence ATTTTGTACTGTGGAAACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 0, 2: 4, 3: 48, 4: 336}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010387415_1010387420 15 Left 1010387415 6:75297880-75297902 CCTTTGTTTCCACAGTACAAAAT 0: 1
1: 0
2: 4
3: 48
4: 336
Right 1010387420 6:75297918-75297940 CATCTCAAAAATCCCTTTCAGGG No data
1010387415_1010387419 14 Left 1010387415 6:75297880-75297902 CCTTTGTTTCCACAGTACAAAAT 0: 1
1: 0
2: 4
3: 48
4: 336
Right 1010387419 6:75297917-75297939 GCATCTCAAAAATCCCTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010387415 Original CRISPR ATTTTGTACTGTGGAAACAA AGG (reversed) Intronic
900170158 1:1263631-1263653 ATGTTATATTGTCGAAACAAAGG - Intronic
901880452 1:12190942-12190964 ATGTTGGCCTGAGGAAACAAGGG - Exonic
902803852 1:18848712-18848734 ATTGTGAACTGTGCATACAAGGG + Intronic
903002300 1:20274952-20274974 TTTTTGTAATGAGGAAACTAAGG - Intergenic
905346431 1:37314131-37314153 ATTCTTTACTGTGGAAGCAATGG - Intergenic
906965988 1:50457065-50457087 ATTCTTTACTGTGAAAACTAGGG - Intronic
907522811 1:55035679-55035701 ATTTTGTACTGTGCTTAGAAAGG - Intergenic
907807122 1:57831910-57831932 GCTTTGTTCTGTGGAAACAAAGG + Intronic
907903872 1:58766458-58766480 TTTTTGTACTGGGGATACAGTGG - Intergenic
908694746 1:66826146-66826168 ATTTTCTACAGTAGAAAAAAGGG - Intronic
908863436 1:68517562-68517584 ATTTTGTAATGTGCAAAAACTGG - Intergenic
909353146 1:74677154-74677176 ATTTGGTACTGGGAATACAAAGG - Intergenic
909963838 1:81882404-81882426 ATTTTTTACTGTTTAAAAAAAGG - Intronic
910283911 1:85531821-85531843 ATTTTCAACTGGGGAAACAGAGG + Intronic
910322790 1:85967742-85967764 ATTGTGAACTGTGCAAGCAAGGG - Intronic
911396417 1:97316073-97316095 ATTTTGTCTTGCGGACACAAAGG - Intronic
911573010 1:99540455-99540477 ATTGTGAACTGTGCATACAAGGG - Intergenic
911762764 1:101635542-101635564 ATTTTGTACAGTGGAATGAGTGG + Intergenic
912156251 1:106924173-106924195 ATTTTCTACTTTTAAAACAATGG + Intergenic
912234320 1:107832791-107832813 ATTTTGTACAATGTAATCAATGG - Intronic
914206108 1:145531164-145531186 ATTTTCAACTGGGGAAACAGAGG - Intergenic
915689686 1:157676245-157676267 ATTTTGAAATGTGAAAACATGGG + Intronic
915946042 1:160152550-160152572 ATTATATTCTGTGGAAACAAGGG - Intronic
916541833 1:165764305-165764327 ATTAGGTACTGTGGATACAATGG + Intronic
916666010 1:166968175-166968197 ATTTAGTACTGTAGGAAGAATGG - Intronic
917242856 1:172967795-172967817 GTTTTGTTCTCTGGAAACCATGG + Intergenic
918502824 1:185217424-185217446 ATTGTGAACTGTGCATACAAGGG + Intronic
918792123 1:188841822-188841844 ATTTTGTACTTTTAAATCAAGGG + Intergenic
919672737 1:200352673-200352695 ATTTTGTTTTATGAAAACAAAGG + Intergenic
920187712 1:204171793-204171815 ATTATGTACTGTGTAAACAAAGG + Intergenic
921376603 1:214480798-214480820 ATTATGTGCTGTGGGAATAATGG - Intronic
921713101 1:218392505-218392527 CTCTTGTACTGTTGGAACAATGG + Intronic
921896823 1:220410471-220410493 ATTTTCAAATGTTGAAACAAAGG - Intergenic
922109082 1:222540072-222540094 ATTTTGAAAGGTGGAAACTATGG - Exonic
923614292 1:235524107-235524129 ATTTTACAATGAGGAAACAATGG - Intergenic
924391422 1:243563780-243563802 ATTTTGGACTTTGCAAAGAAGGG - Exonic
924596628 1:245450786-245450808 ATTTTTTACTGTTCAAAAAATGG - Intronic
1063310023 10:4943496-4943518 ATTTTTTACAGTGGCAACACAGG + Intronic
1063317273 10:5018626-5018648 ATTTTTTACAGTGGCAACACAGG - Intronic
1063333318 10:5184314-5184336 ATTAAGGACTGTGGACACAAAGG - Intergenic
1065631426 10:27684882-27684904 ATTGTGAACTGTGCATACAAGGG - Intronic
1065732660 10:28723463-28723485 ATTTTGTATGGGGGAAAAAATGG - Intergenic
1066590891 10:36993026-36993048 CTTTTGTGATGTGGAAACTAGGG - Intergenic
1066805228 10:39242804-39242826 ATTCAGTAGTGTGGAAACACAGG + Intergenic
1066807515 10:39275221-39275243 ATTTAGCAGTTTGGAAACAATGG - Intergenic
1066807753 10:39278831-39278853 ATTTAGCAGTTTGGAAACAATGG - Intergenic
1066823055 10:39520618-39520640 AAACTGTACTGTGGAAAGAAAGG - Intergenic
1067129104 10:43545457-43545479 CCTTTGTGCTGTGGAAACTATGG - Intergenic
1068357685 10:55931209-55931231 ATTTTGTACATAGGAAACACAGG - Intergenic
1068639371 10:59385369-59385391 ATTTTGTTAAGTGGAAAAAATGG - Intergenic
1070271482 10:74960702-74960724 ATTTTCTAATGAGGAAACAGGGG - Intronic
1070319777 10:75345822-75345844 ATTCCGTGCTGTGGGAACAATGG + Intergenic
1073409475 10:103328430-103328452 ATGCTGTACTGTGGTAATAACGG - Intronic
1073659955 10:105463855-105463877 ATTGTGAACTGTGGATACGAAGG + Intergenic
1073836239 10:107446104-107446126 ATTTGTTTCTGGGGAAACAATGG - Intergenic
1073873807 10:107898204-107898226 ATTTTGTATTATGAAAAAAATGG - Intergenic
1074800750 10:116998701-116998723 ATCTTGTAGTGTGGAAACTAAGG - Intronic
1074847536 10:117411510-117411532 TTTTTGTATTCAGGAAACAAAGG + Intergenic
1074988732 10:118682632-118682654 ATTCTGTACTGACCAAACAAGGG - Exonic
1077742411 11:4860821-4860843 ATTTTTTACTGTCTAAACACTGG - Intronic
1078381383 11:10844724-10844746 ATTTTGTACTCTAGGAAAAAAGG - Intronic
1078921124 11:15831622-15831644 ATTTTATAATGTGGAAACTGAGG - Intergenic
1078990900 11:16645294-16645316 GTTTTGTAGTGGTGAAACAACGG - Intronic
1079863704 11:25707832-25707854 TTTATGTACTGAGGATACAATGG + Intergenic
1080088882 11:28320197-28320219 TTTTTGAGCTGTGAAAACAAAGG + Intronic
1081239734 11:40690275-40690297 ATTTTACAATGTGGAAACTAAGG + Intronic
1081270206 11:41073816-41073838 ATGTAGCACTGAGGAAACAAGGG - Intronic
1081299213 11:41429565-41429587 ATTTTGCATTGTGGGAACAATGG + Intronic
1081367671 11:42256304-42256326 ATTTTGAAATGTGGAAAATAGGG + Intergenic
1081443227 11:43102732-43102754 ATTTTGCATTGTGGGAACTATGG + Intergenic
1082310435 11:50639689-50639711 ATTTTGCAGTTTGGAAACACTGG + Intergenic
1084343181 11:68522988-68523010 ATTTAGAAATGTGGAAATAAGGG - Intronic
1085732638 11:79012487-79012509 ATTTTCTCCTTTGGAAACAAGGG - Intronic
1086066791 11:82754093-82754115 ATTTTTTCCTGTGTAAACAGAGG - Intergenic
1086917579 11:92548258-92548280 ATTTTATACTGTCGTATCAAGGG + Intronic
1087156177 11:94907112-94907134 AATTTGTATTGTGGAAAAAAAGG + Intergenic
1087438501 11:98152704-98152726 GTTTTGTTACGTGGAAACAAAGG + Intergenic
1087458835 11:98421547-98421569 ATGCTGTAATGTGGAAAGAAAGG - Intergenic
1088054508 11:105558791-105558813 TTATTGTACTGTAGAAACCAAGG - Intergenic
1092018270 12:5178024-5178046 ACTTTGCAATGTGGAAAGAATGG - Intergenic
1092297923 12:7216448-7216470 ATTTTACACTGTGGGAAAAATGG + Intronic
1093068264 12:14681901-14681923 TTTTTGTACTGTAGATTCAAGGG - Intronic
1094337159 12:29372598-29372620 AATTTGTACATTGGATACAATGG - Intronic
1094348745 12:29499508-29499530 GTTTTGAACTCTGGAAACAAAGG - Intergenic
1094709729 12:32949473-32949495 ATTTTTTCCTGTGGAGAGAATGG + Intergenic
1095465058 12:42481725-42481747 ATTTTGTATTGTGAAAAGAATGG - Intronic
1095569394 12:43666260-43666282 AATTAGTACTGTTGTAACAAAGG - Intergenic
1096512617 12:52139762-52139784 ATTTTGTATTTTGGAGACAATGG + Intergenic
1096897053 12:54832207-54832229 ATTTTTAAATGTGTAAACAAAGG - Intronic
1097646266 12:62238144-62238166 TTTTTATAGTGTGGAAACAATGG + Intronic
1097728387 12:63100025-63100047 ATGTTGTTCTGTGGAAGAAATGG - Intergenic
1098151270 12:67549123-67549145 ATTTTGTACCATAGAAAAAAAGG + Intergenic
1099330846 12:81284675-81284697 ATTTTTTACTCAGAAAACAATGG + Intronic
1100407932 12:94287180-94287202 ATTCTGTCCTGTGCAGACAAAGG + Intronic
1100986098 12:100203049-100203071 ATTTTGAACTGTGCATGCAAGGG - Intronic
1101639537 12:106577957-106577979 ACAGTGCACTGTGGAAACAAAGG + Intronic
1106666924 13:31861065-31861087 ATATTGGTCTGTGGAAAGAATGG + Intergenic
1107211882 13:37868545-37868567 ATTATGTACTGTGAAAGGAAAGG + Intronic
1108756939 13:53514489-53514511 ATTTTGGAATGTGAAAAGAAAGG - Intergenic
1111063590 13:83058829-83058851 ATTTTGGAATTTGCAAACAAAGG - Intergenic
1111478649 13:88790605-88790627 ATATAGTACTGTGAAAACTAAGG - Intergenic
1111572869 13:90109392-90109414 ATTTTAAAATGTGGAAAAAATGG + Intergenic
1111747434 13:92288351-92288373 ATTTTGTAATGTGGTAACTCTGG + Intronic
1112611552 13:100959914-100959936 ATTGTGTATTATGGAGACAAAGG - Intergenic
1113659309 13:112094472-112094494 ATTGAGTGCTGTGGAGACAAAGG - Intergenic
1114254109 14:20987250-20987272 ATCTTGTGCTGTGAAAAAAAAGG + Intergenic
1114277134 14:21156840-21156862 ATTTTGTTCTCTGGAAATGATGG - Intergenic
1114728028 14:24959855-24959877 CTTTTGTACTGTTTAAAAAAGGG - Intronic
1115346857 14:32352344-32352366 ATTTTGTACTGTTTAAATCAGGG + Intronic
1115351968 14:32405338-32405360 ATTTTGTCCTGTACAAGCAAGGG - Intronic
1116189231 14:41641843-41641865 ATTTTGCACTATAAAAACAAAGG - Intronic
1116514141 14:45785788-45785810 ATTAAGGAGTGTGGAAACAAGGG - Intergenic
1118031523 14:61822588-61822610 CTGTTGCACTGTAGAAACAATGG + Intergenic
1119788297 14:77328637-77328659 ATTTTATAATGAGGAAACAGAGG + Intronic
1119814970 14:77557913-77557935 AATCTGTAGTGTGGCAACAATGG - Intronic
1121486571 14:94321074-94321096 ATTTTATACTGTGGAAACTGAGG - Intronic
1121939926 14:98060578-98060600 ATTCTGTGCTGAGGAAATAATGG + Intergenic
1124907724 15:33886883-33886905 ATATTGGACTGTGGCAAGAAGGG - Intronic
1126443046 15:48712257-48712279 ATTTTCAACTGTGGAAAATAAGG + Intergenic
1126474930 15:49055344-49055366 ATTGTGAACTGTGCACACAAGGG - Intergenic
1126524091 15:49630911-49630933 ATTGTGAACTGTGCATACAAGGG + Intronic
1127481757 15:59384144-59384166 ATTTTTTTTTGTAGAAACAAGGG - Intronic
1129985099 15:79912076-79912098 ATTGTGAACTGTGCACACAAGGG + Intronic
1129998510 15:80027210-80027232 ATTTTGTACAGTAGCTACAAGGG + Intergenic
1130780247 15:87029617-87029639 ATTTTATAATGAGGAAACTAAGG + Intergenic
1130987558 15:88854749-88854771 AAATTTTACTGTGGAAAGAATGG + Intronic
1131933632 15:97475699-97475721 ATTTTGAACTGTGCATGCAAGGG + Intergenic
1134029636 16:10981539-10981561 GTTTTGTACTGTTTGAACAAGGG - Intronic
1134230960 16:12430095-12430117 ATTGTGAACTGTGCATACAAGGG + Intronic
1134599408 16:15521667-15521689 ATTTTGCACATTGGAAACCAGGG - Intronic
1135306483 16:21371547-21371569 ATTTTTTTCTGTAGAGACAAGGG - Intergenic
1138925734 16:61589055-61589077 AATTTGCACTGTTGAATCAAAGG + Intergenic
1139196051 16:64919838-64919860 ATTTAGTAAAGTGGAAACAAAGG - Intergenic
1139968468 16:70758756-70758778 ATTCTGCACTGTGGAAATCAGGG + Intronic
1144064086 17:11608691-11608713 ATTATGTACTGAGTAAACACTGG - Intronic
1147045453 17:37748237-37748259 ATTTTGCACTGAGGAAACTGAGG - Intergenic
1147361593 17:39934117-39934139 ATTTTGGGCTGTGGAGAGAAAGG + Intergenic
1155646735 18:28087604-28087626 ATTTTGAAGTGTGGAGACAAGGG - Intronic
1158185495 18:54766814-54766836 ATTCTGAAGTGAGGAAACAATGG + Intronic
1158569909 18:58589405-58589427 ATTTTGTGCTTTGGGAACAAGGG + Intronic
1158799652 18:60891174-60891196 ATTTTGTACTGTGGCCATGATGG - Intergenic
1158915876 18:62128663-62128685 CTTTTGTAATGTGAAAACAAAGG - Intronic
1159543109 18:69805007-69805029 TCCTTGTACTGTGGAAGCAAAGG + Intronic
1159732064 18:72040419-72040441 CTTTTGTACTGTGGAATCACTGG + Intergenic
1159953201 18:74500487-74500509 AATTTGGACTGTGGCAACATTGG + Intronic
1161830978 19:6604036-6604058 ACTTTGTACTTTGCAGACAAGGG - Intronic
1162974495 19:14200786-14200808 ATTTTGTATTCTGTAAAGAAGGG + Intronic
1164194519 19:22944330-22944352 ATTTAGGAATGTGGACACAAGGG - Intergenic
1164658945 19:29945800-29945822 ATTGTGTACTTTTAAAACAATGG - Intronic
1165966415 19:39584586-39584608 GTTCTGTACTGGGGAAAGAAAGG + Intergenic
1168192634 19:54750888-54750910 GTTTTGTACTGTGGAGCCACAGG + Intronic
925674707 2:6349898-6349920 ATTATGTCATGTGGAAACTAAGG + Intergenic
925780282 2:7375644-7375666 ATTTTGTCCAGTGGAAATACTGG - Intergenic
925830545 2:7889922-7889944 ATTGTTGACTGTGGAAAGAAGGG + Intergenic
926762233 2:16288230-16288252 ATTTTGTACATTGCAAAAAATGG - Intergenic
926791827 2:16580616-16580638 ATTTTTTATTGTAGAAACTAAGG + Intronic
927015051 2:18950993-18951015 AAAGTGTTCTGTGGAAACAAGGG - Intergenic
927835364 2:26393279-26393301 ATTCTGCACTGTAGAAACACTGG - Exonic
928694843 2:33839018-33839040 ATATTATACTGTGTATACAAGGG - Intergenic
928757960 2:34547970-34547992 AATTTCTCCTGTGGAGACAAAGG + Intergenic
929327872 2:40639551-40639573 AGTTTATACTGTGGAAACAAGGG + Intergenic
931284055 2:60817941-60817963 CTTTAATGCTGTGGAAACAATGG - Intergenic
932823464 2:74920670-74920692 ATTTTATAATGAGGAAACATAGG + Intergenic
933249311 2:80010938-80010960 ATTTTCAAGTGTGGAATCAATGG + Intronic
934046891 2:88179780-88179802 ATTTTATAATGAGGGAACAAAGG + Intronic
935279748 2:101507028-101507050 ATTTTGTGGTGTGCAACCAAGGG + Intergenic
937620207 2:123976648-123976670 TTTTTGTCCTGGAGAAACAAAGG + Intergenic
937643454 2:124239110-124239132 TTTTTTTACTGTGGGAAAAAGGG + Intronic
938682343 2:133704492-133704514 ATGATTTACTGTGGATACAATGG + Intergenic
939731618 2:145791696-145791718 ATTTTATACTGTAGGAAAAAAGG - Intergenic
940543840 2:155057288-155057310 AGTTTGGACTGTAGTAACAAAGG + Intergenic
941244259 2:163077727-163077749 ATATTGAAAAGTGGAAACAAAGG + Intergenic
942610653 2:177738975-177738997 ATTTTAAACTGCAGAAACAAGGG - Intronic
943067785 2:183106885-183106907 ATTTCCTACTGTGGAAGGAAGGG - Intergenic
943097055 2:183441906-183441928 ATTTTAAACTGTTGAAAAAATGG + Intergenic
943150200 2:184101851-184101873 ATTTTCTAGTTTGAAAACAATGG + Intergenic
943150316 2:184103683-184103705 ATTTTCTAGTTTGAAAACAATGG - Intergenic
943523088 2:188978740-188978762 TTTTTTGAGTGTGGAAACAATGG - Intronic
948734715 2:239994373-239994395 ATTGTGAACTGTGCATACAAGGG + Intronic
949012588 2:241689693-241689715 AGGTTGTGCTGTGGTAACAAAGG - Intergenic
1169955109 20:11093727-11093749 AGTTTGGATTTTGGAAACAAAGG + Intergenic
1170031870 20:11952535-11952557 ATTATGTACTGGGAAAACACAGG + Intergenic
1170490472 20:16868089-16868111 ATTATGTCATCTGGAAACAAGGG - Intergenic
1171227033 20:23450534-23450556 ATTTTGTACTGTTCAAACCAGGG + Exonic
1172657055 20:36543752-36543774 AGTGTTTACTGTGGAAGCAAGGG + Intronic
1172832950 20:37852040-37852062 ATTTTTTACTGTGCAAAGCAGGG - Intronic
1174709933 20:52693694-52693716 GCTTTGTTCTATGGAAACAAAGG - Intergenic
1177243336 21:18490072-18490094 ATTGTGAACTGTGCAAGCAAGGG - Intergenic
1177729656 21:25011858-25011880 ATTTTGCAACTTGGAAACAAGGG - Intergenic
1177828835 21:26113993-26114015 ATAAAGTACTGTGGGAACAATGG - Intronic
1179629445 21:42667503-42667525 GTTTTGTTCTCTTGAAACAAAGG + Intronic
1182405133 22:30121078-30121100 ATTTTGTAGTGTGGACAAGAAGG + Intronic
1182801562 22:33035752-33035774 ATTTTTTATTGTGGAGACAGGGG + Intronic
1183695557 22:39419938-39419960 GTTGGGTACTGTAGAAACAAGGG + Intronic
1184026726 22:41863197-41863219 CTTTTGTAGTGAGGAAACCAAGG + Intronic
1203237910 22_KI270732v1_random:24529-24551 ATTTTATACTGTAGTAAGAAGGG + Intergenic
949908197 3:8877099-8877121 ATTTTGTATTTTGGAATCAAAGG + Exonic
950359878 3:12442632-12442654 TTTTTGCACGGTGGAGACAAAGG + Intergenic
951304331 3:21039802-21039824 ATTTTCTAATGTAGAAACATAGG + Intergenic
951397871 3:22192287-22192309 TCTTTGTTCTGGGGAAACAAAGG - Intronic
952220807 3:31322361-31322383 ATCTTTTACTGTGGATTCAAGGG + Intergenic
952314945 3:32224468-32224490 ATTCTGTGCTGTGGACACCAAGG + Intergenic
953221686 3:40977535-40977557 ATCTTGTACTGTGAAGACAAGGG - Intergenic
954861302 3:53693093-53693115 ATATTTTACTGTGTAAACAAGGG + Intronic
955766551 3:62350137-62350159 ATTTTGAACTTTGGACACAAAGG + Intergenic
955995600 3:64677435-64677457 ATTGGGTACAGAGGAAACAAGGG + Intronic
956123008 3:65984875-65984897 ATTTTGTACCATGGAGACAAGGG + Intronic
956188362 3:66584004-66584026 ATTTTGTCATTTGGAAAAAAGGG - Intergenic
956258188 3:67307046-67307068 TTTTTGTACTGTAAAACCAATGG - Intergenic
957156695 3:76552645-76552667 ATAGTGTAGTGTGGAAACTATGG + Intronic
957181361 3:76882265-76882287 AATTTGTACTGTTGAAACATTGG - Intronic
957197290 3:77085610-77085632 AGTTTGTATCTTGGAAACAAAGG - Intronic
957599536 3:82316144-82316166 ATTTTCTAATCTGGAAAAAAAGG + Intergenic
957996330 3:87694459-87694481 ATTTTGTAAACTGAAAACAAAGG + Intergenic
958004765 3:87796704-87796726 ATTTTGTACTTTAGCAACATTGG - Intergenic
958720799 3:97840476-97840498 ATTAAGTACTGAGCAAACAATGG - Intronic
959053197 3:101543874-101543896 TTTTTTTTCTGTGGAAATAAGGG + Intergenic
959308862 3:104704786-104704808 ATTTTTTGCTGTTGAAAGAATGG - Intergenic
959348071 3:105224287-105224309 ATTTTGTTTTATAGAAACAAAGG - Intergenic
959778496 3:110199832-110199854 ATTTTGTAGTGTGGTGGCAATGG - Intergenic
962307235 3:134299676-134299698 ATTGTGTACTGGGGAAGCCAAGG + Intergenic
963513574 3:146279308-146279330 CTTTTTTACTGTGGAAGAAACGG - Intergenic
963524408 3:146398742-146398764 ATTTTGAACTTTGGCAAGAATGG + Intronic
964164241 3:153682348-153682370 ATTATGGAGTGTGGACACAAAGG - Intergenic
964282700 3:155083584-155083606 ATTTTGAACTGTAAAAATAAAGG + Intronic
965119360 3:164531686-164531708 TTTATGTAATGTTGAAACAAAGG - Intergenic
965722501 3:171677138-171677160 TTTTTATCCTGTTGAAACAATGG + Intronic
971417856 4:26450190-26450212 CTTTTGAACTGTGGAATCTAAGG - Intergenic
971733253 4:30413347-30413369 ATATTGTAATGTGGTAACATTGG - Intergenic
971962930 4:33512258-33512280 GTTTTGTAAGGTGGGAACAATGG - Intergenic
972805171 4:42522594-42522616 ATTTTGTCCTGGGGAAAAATTGG - Intronic
973133127 4:46672984-46673006 ATTGTGAACTGTGCATACAAGGG - Intergenic
973231279 4:47841753-47841775 ATGTGGTTCTGTGGAAATAAAGG + Intergenic
973255190 4:48103768-48103790 TCTTTGTTCTTTGGAAACAAAGG - Intronic
974030510 4:56772204-56772226 AGTTAGTACTGTGGAAATAAGGG - Intergenic
974251245 4:59387521-59387543 ATTTTAGACTGGAGAAACAAAGG - Intergenic
974407462 4:61493470-61493492 ATTTTACAATGTTGAAACAATGG - Intronic
974512539 4:62863465-62863487 ATTTTGTACTATGAGAACAGAGG - Intergenic
974616844 4:64297520-64297542 ATATTGTACAGAAGAAACAAAGG - Intronic
974873678 4:67675879-67675901 ATTTTGTACTGTGAACTCAAAGG + Intronic
975290158 4:72668545-72668567 GTCTTGAACTGAGGAAACAAAGG + Intergenic
975789230 4:77930449-77930471 ATTGTGAACTGTGCATACAAGGG + Intronic
975938813 4:79615204-79615226 GTTTTGTACTGAGAATACAAAGG - Intergenic
976266405 4:83189661-83189683 GTTTGGTCCTGTGGCAACAAAGG - Intergenic
977116442 4:93034722-93034744 ATTTTTTTCTGTTGAAACATTGG - Intronic
977129085 4:93211232-93211254 AATTTGTACTTTGGAAGAAATGG + Intronic
978331384 4:107616615-107616637 ACTTTATACTGTGGCAAAAAGGG + Intronic
978388364 4:108199134-108199156 ATTTTGCAATATGGAAATAAGGG + Intergenic
978452353 4:108848396-108848418 ATTTAGTTTTGTGGAAACTATGG + Intronic
979531924 4:121777677-121777699 ATTTTTTACTGCCAAAACAAGGG + Intergenic
979548983 4:121969151-121969173 ATTTTTTACAGTGGAAGAAAAGG - Intergenic
979741594 4:124158073-124158095 AATTTGCACAGTGGAAAAAAGGG - Intergenic
980270825 4:130581689-130581711 ATTAAGTACTATGGAAACACTGG - Intergenic
981560061 4:146038017-146038039 ATTTTTTACTTTCTAAACAAAGG - Intergenic
981772809 4:148329521-148329543 AATATGTACTGTGGAAAAAAGGG - Intronic
981912943 4:150003184-150003206 ATTCTATAATGTGGAAACAGAGG + Intergenic
983022420 4:162694366-162694388 AATTTGTATGATGGAAACAATGG + Intergenic
985921311 5:2978336-2978358 TTGCTGTGCTGTGGAAACAAAGG - Intergenic
986834607 5:11621227-11621249 ATTTTGTAATATGGATACATTGG + Intronic
987518374 5:18945698-18945720 ATTTTGCAGTGTGGAAACTATGG + Intergenic
987730615 5:21766663-21766685 ATTTTATACTGTGTAAATAATGG - Intronic
990245269 5:53858072-53858094 ATTATGAACTGTGCATACAAGGG - Intergenic
990346331 5:54875382-54875404 ATTTAGTACTGAGGATTCAATGG + Intergenic
991253855 5:64593597-64593619 ATTATGTAGTCTGGAAAAAAGGG - Intronic
991370700 5:65916510-65916532 ATTATATACTTTGGAAACCATGG - Intergenic
991544511 5:67766547-67766569 ATTTTCTACTGAGGAATCAATGG - Intergenic
993311535 5:86338467-86338489 ATTTTGAAGTGTGGGGACAATGG - Intergenic
997919338 5:137963801-137963823 ATTGTGAGCTGTGCAAACAAGGG + Intronic
999024292 5:148208153-148208175 TCTTAGTAATGTGGAAACAAAGG - Intronic
1000179581 5:158795007-158795029 ATTTTCTACTCAGCAAACAAGGG - Intronic
1000858105 5:166425219-166425241 ATTTTCTGCTTTGGAAACCAGGG - Intergenic
1001109085 5:168880671-168880693 ATTTTATACAGTGGAAACATAGG + Intronic
1003712980 6:8614140-8614162 ATTGTGAACTGTGGATGCAAGGG + Intergenic
1004136021 6:12967612-12967634 ATCTGGTAGTGTAGAAACAAAGG + Intronic
1004277580 6:14252262-14252284 ATTTGCTACTGTGGAAAAGATGG + Intergenic
1006954655 6:37857386-37857408 ACATGGTACTGTGGAAACAATGG + Intronic
1007440404 6:41854541-41854563 ATTTTGTTCTTGGGAAACACTGG + Intronic
1008098877 6:47370167-47370189 ATTTTATACTGAGGAAACTAAGG - Intergenic
1008551916 6:52640790-52640812 ATTTTATACTGAGGAAACTAAGG + Intergenic
1008787474 6:55186905-55186927 GTTCTGGACTGTGCAAACAATGG + Intronic
1009445275 6:63735244-63735266 ATTTTGTGCAATGGAAACAATGG + Intronic
1009979153 6:70705817-70705839 ATTTTTTAGTGTGGAAACTGAGG + Intronic
1010387415 6:75297880-75297902 ATTTTGTACTGTGGAAACAAAGG - Intronic
1010978472 6:82342762-82342784 GTTTAGCATTGTGGAAACAAGGG + Intergenic
1011147101 6:84229643-84229665 ATTTTCTATTGTGTAGACAATGG - Intergenic
1011477690 6:87763979-87764001 GTTCAGTACTGAGGAAACAAAGG + Intergenic
1011575821 6:88797846-88797868 ACTTTGTACTGTGGAAGAATAGG - Intronic
1012088832 6:94865591-94865613 ATTTTTTTCTGTTGAAATAAAGG - Intergenic
1013259994 6:108432377-108432399 GTAGGGTACTGTGGAAACAAAGG - Intronic
1013449941 6:110270387-110270409 ATTTTTTTCAATGGAAACAAAGG + Intronic
1013678380 6:112492877-112492899 ATTTTGTACTGTGGAGAATCTGG + Intergenic
1013892531 6:115042721-115042743 ATTTTGTAAAGTGAAAACATAGG + Intergenic
1014997928 6:128175538-128175560 ATAATGTTCTGTAGAAACAAAGG + Intronic
1015357123 6:132291561-132291583 ATGTTGTACTGTGGTAATTATGG - Intergenic
1015448921 6:133341618-133341640 CTTTTCTAATGTTGAAACAAAGG + Intronic
1015517165 6:134094432-134094454 GCTTTGTTCTGTGGAACCAATGG + Intergenic
1015683827 6:135837168-135837190 ATTTTCTACTGTGGAGACAATGG + Intergenic
1015867939 6:137746465-137746487 ATTTTATACTTTAAAAACAAAGG + Intergenic
1017915388 6:158827613-158827635 ATTTTGTAATGTTTAAAAAATGG + Intergenic
1017926666 6:158916619-158916641 ATTTAGCACTTTGGAAACAGAGG + Intergenic
1018823493 6:167392403-167392425 ATTTTGTACTATTTAAAGAATGG - Intergenic
1019831952 7:3339566-3339588 AATTTGTTCTGTGGCAATAATGG + Intronic
1021683600 7:23159340-23159362 ATTTTTTTGTGTGGAGACAAGGG + Intronic
1022407434 7:30104455-30104477 ATTTTGGTGTGTGGAAACAATGG + Intronic
1024127239 7:46312007-46312029 ATTGTGAACTGTGCATACAACGG - Intergenic
1026300529 7:69093935-69093957 ATTGTGAACTGTGCATACAACGG - Intergenic
1026386671 7:69856778-69856800 ACTGTGTCCTGTAGAAACAAGGG - Intronic
1027448912 7:78306981-78307003 ATTTTGTGCTCTGGAAATAATGG - Intronic
1028055375 7:86234195-86234217 ATTTTGAAATGTGGAAAGAGAGG + Intergenic
1028188511 7:87818502-87818524 ATTTTGGACAGTTGAGACAATGG + Intronic
1028350822 7:89845345-89845367 ATTGTGTATGGTGGAAATAAAGG - Intergenic
1028682903 7:93558764-93558786 CTCTTGAACTGTGGAAACGATGG + Intronic
1028819673 7:95192629-95192651 TTTTACAACTGTGGAAACAAAGG + Intronic
1028847453 7:95497891-95497913 ATTTTGTTATGTGTATACAATGG - Intronic
1028935736 7:96462302-96462324 ATTTGGTAATGTGGAAATCATGG - Intergenic
1030865263 7:114694754-114694776 ATTTTGTGCTGTTGAATCAATGG + Intergenic
1032374721 7:131400897-131400919 TTTTTGTACTGTGAATACTATGG + Intronic
1033512280 7:142070766-142070788 AGTTTGTATGGTGGAAGCAAAGG + Intronic
1033515308 7:142099385-142099407 AGTTTGTACAGTGGAAGCAAAGG + Intronic
1034383472 7:150719290-150719312 ATTTTATACTGTGGAACCAAGGG - Intronic
1035021245 7:155801951-155801973 AGTTTGTACAGAGAAAACAAAGG - Exonic
1036836041 8:12068381-12068403 ATTATATATTGTGGAAACTAAGG - Intronic
1036857883 8:12314951-12314973 ATTATATATTGTGGAAACTAAGG - Intergenic
1038838886 8:31160515-31160537 ATTCTGCACTGGAGAAACAAAGG - Intronic
1038926650 8:32148027-32148049 CTTTTATAATGTGAAAACAAAGG + Intronic
1038954098 8:32448672-32448694 TTTTTTTTCTGTGTAAACAATGG + Intronic
1039801190 8:40956080-40956102 ATGGTGTTCTTTGGAAACAATGG - Intergenic
1041320284 8:56605294-56605316 ATTTTTTACTGTTGAAAAATTGG - Intergenic
1041511338 8:58658422-58658444 ATTTCGTACTGTGGACACACTGG + Intronic
1041593466 8:59619003-59619025 ACTTTGAAATGTGGAAATAAGGG - Intergenic
1041938140 8:63357353-63357375 ATTTTGTACTTTGAAATAAATGG - Intergenic
1042100617 8:65271803-65271825 ATTCTGAAATGTGGACACAAAGG - Intergenic
1043274830 8:78379796-78379818 ATTTAGTAGTGGGGAAATAAAGG + Intergenic
1044653677 8:94525022-94525044 ATTGTGTACTGGGAAATCAATGG - Intronic
1044680745 8:94775041-94775063 ATATTTCACTGTGGATACAAGGG + Intronic
1044762796 8:95539568-95539590 AAATTGTACTGAGGAAAGAAAGG - Intergenic
1044777520 8:95707091-95707113 ACTGTGTACTGTGGAAAAGAGGG - Intergenic
1045050215 8:98317763-98317785 ATTTTGTAATGTATAAACCATGG + Intergenic
1045647305 8:104311885-104311907 AGTTTGTTCTGTGGAATCGATGG - Intergenic
1046358540 8:113119248-113119270 AATATGTATTGTGTAAACAAAGG + Intronic
1046536870 8:115526013-115526035 ATTTTACACTGTGGGAAGAAGGG + Intronic
1046685724 8:117224771-117224793 ATTATTTGCTGTGGACACAAAGG + Intergenic
1046793856 8:118349337-118349359 ATTTTGTAGTGTGTAGACACAGG + Intronic
1048642833 8:136383435-136383457 ATTTTCTACAGTGGCTACAATGG + Intergenic
1048648600 8:136450104-136450126 ATTTTGTACTCTGGAAAATGGGG - Intergenic
1048798631 8:138175183-138175205 ATTGTGTACTGTGGTAATTATGG - Intronic
1048825044 8:138416140-138416162 ATTTTGTCCTGGGGGATCAAGGG - Intronic
1049626036 8:143621861-143621883 ATTGTGAACTGTGCAGACAAGGG - Intergenic
1050090598 9:2014689-2014711 AGTGTGGACTGTGGAAAAAACGG - Intergenic
1050472204 9:6005760-6005782 ATAATGCACTGTGGAGACAAGGG + Intronic
1050830429 9:10004314-10004336 AATTTGCCATGTGGAAACAAAGG + Intronic
1051040131 9:12799089-12799111 ATTTAGTATTGCGGAAAAAAGGG + Intronic
1051093276 9:13435487-13435509 ATTTAGTACTATGAAAACATTGG - Intergenic
1051288639 9:15522803-15522825 AGTTTGTATTGTGAAAACGAAGG - Intergenic
1051806754 9:21002821-21002843 ATTTTGTACAGTGTAGACAAAGG - Exonic
1051982745 9:23044285-23044307 ATATTCTACTGTTGAAAAAATGG - Intergenic
1052044244 9:23775954-23775976 ATTTTTTACTGGGGAGATAAAGG - Intronic
1052141930 9:24996623-24996645 ATTTATGACTGTGAAAACAATGG + Intergenic
1054861702 9:69960383-69960405 ATTTTGTAAGGTGGGAACAAGGG + Intergenic
1055160141 9:73116770-73116792 ATTCTGTACTGTGAAAAAAATGG + Intergenic
1055737652 9:79349281-79349303 ATTTTGTAGAATGGAAACAAAGG - Intergenic
1056115046 9:83433743-83433765 ATTGTGGACTGTGCATACAAGGG - Intronic
1056986751 9:91370634-91370656 ATTGTGAACTGTGCATACAAGGG - Intergenic
1059164364 9:112064336-112064358 ATTGTGAACTGTGCATACAAGGG + Intronic
1186068895 X:5796091-5796113 ATTGTGAACTGTGGATGCAAGGG - Intergenic
1186103921 X:6185607-6185629 ATTTTGTACAGTTAAAACCAGGG - Intronic
1186748773 X:12599365-12599387 ATTATGTTCTCTGTAAACAATGG + Intronic
1187296925 X:18011314-18011336 ATTTGGTACAATGGAAACAATGG + Intergenic
1188266799 X:28086850-28086872 ATTTTGTTTTCTGGAAAAAAGGG + Intergenic
1188311418 X:28621228-28621250 ATTAGGTACTGGGGAAGCAATGG - Intronic
1188883676 X:35522611-35522633 GTTTTGTTCTTTGGGAACAATGG - Intergenic
1189337301 X:40177598-40177620 GGTTTGTACTGTGGATACCAAGG - Intergenic
1190329630 X:49227725-49227747 AATATGTACTGTGGAAAGAAAGG - Intronic
1190575115 X:51828166-51828188 AATGTGTACTGTGAAAACTAGGG - Intronic
1192734040 X:73831606-73831628 ATTTTGTGCTGAGAACACAAGGG - Intergenic
1193557103 X:82968322-82968344 ATTTAGTATTATGGAAGCAAAGG + Intergenic
1194353177 X:92847578-92847600 ATTTTCTACCCAGGAAACAAAGG + Intergenic
1194697432 X:97071643-97071665 ATTTTGTACCATTAAAACAAAGG + Intronic
1196004825 X:110824388-110824410 ATATTGTATTGTGGAAACTCTGG - Intergenic
1197089698 X:122521877-122521899 ATATTGTAATATGGTAACAATGG - Intergenic
1197692766 X:129521567-129521589 ATTTTGTATTGTGAAAAAACGGG - Intronic
1197761317 X:130030429-130030451 ATTTTGTAGTGAGGAAACTGAGG + Intronic
1197916171 X:131538213-131538235 ATTTGGCACTGAGGATACAATGG - Intergenic
1198401760 X:136275477-136275499 ATTTTATGCTGTGGAAACCAGGG + Intergenic
1200032787 X:153310026-153310048 ATTTTGCACTGTTGCAACCATGG + Intergenic
1200114127 X:153762696-153762718 ATTTTCTTCTGTGGAAAGGAAGG + Intergenic
1200242234 X:154503020-154503042 TTTTTGTACAGTGGGGACAATGG + Intergenic
1200661534 Y:5964662-5964684 ATTTTCTACCCAGGAAACAAAGG + Intergenic
1201501467 Y:14647860-14647882 ATTTTGTGCTTTTAAAACAATGG + Intronic