ID: 1010388154

View in Genome Browser
Species Human (GRCh38)
Location 6:75306009-75306031
Sequence CTGTCTTCACAAATGGAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010388149_1010388154 22 Left 1010388149 6:75305964-75305986 CCATTCACCCCTACAAAAAGCAC 0: 1
1: 0
2: 1
3: 19
4: 183
Right 1010388154 6:75306009-75306031 CTGTCTTCACAAATGGAAGTTGG No data
1010388148_1010388154 23 Left 1010388148 6:75305963-75305985 CCCATTCACCCCTACAAAAAGCA 0: 1
1: 0
2: 0
3: 16
4: 192
Right 1010388154 6:75306009-75306031 CTGTCTTCACAAATGGAAGTTGG No data
1010388151_1010388154 14 Left 1010388151 6:75305972-75305994 CCCTACAAAAAGCACATTAAGTT 0: 1
1: 0
2: 0
3: 23
4: 294
Right 1010388154 6:75306009-75306031 CTGTCTTCACAAATGGAAGTTGG No data
1010388150_1010388154 15 Left 1010388150 6:75305971-75305993 CCCCTACAAAAAGCACATTAAGT 0: 1
1: 0
2: 2
3: 20
4: 315
Right 1010388154 6:75306009-75306031 CTGTCTTCACAAATGGAAGTTGG No data
1010388152_1010388154 13 Left 1010388152 6:75305973-75305995 CCTACAAAAAGCACATTAAGTTG 0: 1
1: 0
2: 1
3: 24
4: 278
Right 1010388154 6:75306009-75306031 CTGTCTTCACAAATGGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010388154 Original CRISPR CTGTCTTCACAAATGGAAGT TGG Intronic
No off target data available for this crispr