ID: 1010389896

View in Genome Browser
Species Human (GRCh38)
Location 6:75324846-75324868
Sequence CCTGTTCAACAGACGGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6066
Summary {0: 1, 1: 1, 2: 103, 3: 1315, 4: 4646}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010389888_1010389896 28 Left 1010389888 6:75324795-75324817 CCAACTGATCTTCAACAAGGCGA 0: 1
1: 7
2: 369
3: 710
4: 1680
Right 1010389896 6:75324846-75324868 CCTGTTCAACAGACGGTGCTGGG 0: 1
1: 1
2: 103
3: 1315
4: 4646

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010389896 Original CRISPR CCTGTTCAACAGACGGTGCT GGG Intronic
Too many off-targets to display for this crispr