ID: 1010391436

View in Genome Browser
Species Human (GRCh38)
Location 6:75342780-75342802
Sequence CTGTGGAAATAGCTGAGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 303}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010391436_1010391445 26 Left 1010391436 6:75342780-75342802 CCCTGCCTCAGCTATTTCCACAG 0: 1
1: 0
2: 0
3: 26
4: 303
Right 1010391445 6:75342829-75342851 AGATATTCTTTTAGAGTGGCAGG No data
1010391436_1010391442 -5 Left 1010391436 6:75342780-75342802 CCCTGCCTCAGCTATTTCCACAG 0: 1
1: 0
2: 0
3: 26
4: 303
Right 1010391442 6:75342798-75342820 CACAGCCTTTCAAAGGCACAGGG No data
1010391436_1010391444 22 Left 1010391436 6:75342780-75342802 CCCTGCCTCAGCTATTTCCACAG 0: 1
1: 0
2: 0
3: 26
4: 303
Right 1010391444 6:75342825-75342847 ATCTAGATATTCTTTTAGAGTGG 0: 1
1: 0
2: 3
3: 16
4: 215
1010391436_1010391441 -6 Left 1010391436 6:75342780-75342802 CCCTGCCTCAGCTATTTCCACAG 0: 1
1: 0
2: 0
3: 26
4: 303
Right 1010391441 6:75342797-75342819 CCACAGCCTTTCAAAGGCACAGG 0: 1
1: 0
2: 1
3: 25
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010391436 Original CRISPR CTGTGGAAATAGCTGAGGCA GGG (reversed) Intronic
902554715 1:17240152-17240174 CTGTGGGAACAGGTGAAGCAAGG + Intronic
902748004 1:18486180-18486202 CTAAGGAGAAAGCTGAGGCAGGG + Intergenic
903015975 1:20362042-20362064 CTGTGGAAAGAGGAGTGGCAGGG + Intergenic
903499949 1:23795280-23795302 GTGGGGAAACAGCTGAGGGAAGG - Exonic
903759169 1:25685735-25685757 CTGTGGGAGAAACTGAGGCAAGG + Intronic
904433860 1:30481533-30481555 TTGGGAAAAAAGCTGAGGCAGGG + Intergenic
905032867 1:34899557-34899579 CTGTGGAGAGAGCTCAGGCCTGG - Intronic
905694169 1:39962687-39962709 CTGCGGAGCTTGCTGAGGCAAGG + Intronic
905784853 1:40746798-40746820 CTGTGGATATAGTTTAGGAAAGG - Intronic
906237337 1:44219922-44219944 CTGTGGATATAGGTTGGGCAGGG + Intronic
906475885 1:46169013-46169035 CTGTGAAAAAAGCTGAACCAAGG - Intronic
907784907 1:57602229-57602251 ATGTGGAAAGTGCTTAGGCAAGG - Intronic
909264876 1:73544376-73544398 TAGTAGAAATAGCTAAGGCATGG - Intergenic
909430067 1:75577174-75577196 CTGTTGAAATAGCCCAAGCAAGG - Intronic
910283100 1:85523225-85523247 AAGTGGAAGTAGATGAGGCAAGG + Intronic
911525136 1:98975179-98975201 GTGTGGAAACATTTGAGGCACGG - Intronic
911843486 1:102716639-102716661 TTCTGGAAAGACCTGAGGCAAGG - Intergenic
915401261 1:155623633-155623655 TTGGGGAAAAAGCTGAGGCAGGG - Intergenic
915839624 1:159203825-159203847 CTGGGGAAACAGCTGAGGAGGGG + Intronic
917072802 1:171170510-171170532 CTATGGGAATAGAAGAGGCAAGG + Intergenic
917150145 1:171934638-171934660 CTGTGGTAAGAGCTTAGGCAAGG + Intronic
918937207 1:190937089-190937111 CTGTAGAAATAGCTGGATCATGG + Intergenic
919763124 1:201110837-201110859 CTCTGGAAATGGCTGTGGCGGGG - Intronic
920518179 1:206602207-206602229 CTGTGGAAAGAGTGGAGGGAAGG - Intronic
921293531 1:213680875-213680897 CTGTGTAAATAACTCAGCCAGGG + Intergenic
921338344 1:214110223-214110245 CTGTAGAGAAAACTGAGGCAAGG + Intergenic
922468343 1:225860205-225860227 CTGTGCAAGGAGCTGAGGCAGGG + Intronic
922828298 1:228536849-228536871 TTGGGAAAAAAGCTGAGGCAGGG + Intergenic
923537003 1:234860607-234860629 CTGGGGAAAAATGTGAGGCATGG - Intergenic
923899608 1:238311498-238311520 CTGTGGAAATACCTGAGTGGTGG - Intergenic
924274538 1:242372241-242372263 GTGTGGAAATAGCTGTGCTATGG - Intronic
924385751 1:243496796-243496818 CTTTAGAAATAAATGAGGCAGGG + Intronic
924876091 1:248105925-248105947 TTGGGAAAAAAGCTGAGGCAGGG - Intergenic
1063393803 10:5667643-5667665 GTCTGGAAATAGGTGAGGCCTGG + Intergenic
1064628216 10:17282983-17283005 CTGTGGAAGCAGCTGAGGTGGGG + Intergenic
1065278683 10:24112939-24112961 ATGTGAAAATAGAGGAGGCAGGG + Intronic
1067663664 10:48255471-48255493 ATGTGGTAATGGCTGAGGGAAGG - Intronic
1067683717 10:48455314-48455336 CAGTGGATAGAGCTGGGGCAGGG + Intronic
1067768715 10:49108532-49108554 CAGTTGAAATAGCGGAGTCAGGG - Intronic
1068229850 10:54157369-54157391 ATGTGGAAACTGCTGAGGCTTGG + Intronic
1069929460 10:71872790-71872812 ATGTGGAATCAGCTGAGTCACGG - Intergenic
1070778340 10:79123261-79123283 CTGTGGACCGGGCTGAGGCATGG + Intronic
1072438322 10:95433265-95433287 CTGTGAAGACAGCTGAGGCTCGG - Intronic
1072610840 10:97016957-97016979 CTGTGGTACGAGCTGGGGCAGGG + Intronic
1072662872 10:97373332-97373354 CTGTGGCAGAAGCTGAGCCAGGG + Intronic
1073451185 10:103610319-103610341 ATGTGGGGATTGCTGAGGCAGGG - Intronic
1073456818 10:103641893-103641915 GTGTGGAAATACCTGAGGTTTGG - Intronic
1073527585 10:104199132-104199154 TTGTAGAAATAGTTGAGGTATGG + Intronic
1073833701 10:107416325-107416347 ATGTAGAAATACCTGAGGCTGGG + Intergenic
1076068033 10:127464358-127464380 CTGAGGTCATAGCTGAGCCAGGG + Intergenic
1077269108 11:1666679-1666701 CTGTGGGAATATCTGTGACACGG - Intergenic
1077271439 11:1684035-1684057 CTGTGGGAATATCTGTGACACGG + Intergenic
1078327232 11:10390518-10390540 CTGTGTAAACAACTCAGGCATGG + Intronic
1080305184 11:30827726-30827748 GTGTGGAAAGAGAGGAGGCAAGG - Intergenic
1080525726 11:33115009-33115031 CTGGGCACATAGCAGAGGCAGGG + Intronic
1080847285 11:36037282-36037304 CTGAGGAAATAGCTGAAGACAGG + Intronic
1081307661 11:41533465-41533487 TTGTAGTAATAGCTGAGGGATGG - Intergenic
1081474995 11:43420820-43420842 CTGTGAAAAGATCTCAGGCAAGG - Intronic
1081811151 11:45914799-45914821 CTATGGCAACAGCTGAGTCAAGG + Intronic
1083234486 11:61342879-61342901 CTTTGGAAAGGGCTGAGGGAGGG + Intronic
1083851648 11:65371161-65371183 CTCAGGAAACAGCTGAGCCAAGG - Intergenic
1086787732 11:90992388-90992410 CTCTGGAAATAGAAAAGGCAAGG - Intergenic
1087582981 11:100082839-100082861 GTGAGGAAATACCTGAGGCATGG + Intronic
1088812444 11:113400738-113400760 CTGTGGCTGTAGCTGAGGAAGGG + Intergenic
1088980906 11:114862485-114862507 CTGTGGAACTGGCTCAGGCATGG - Intergenic
1089386026 11:118068613-118068635 CTGGGGAATGAGCTGGGGCAAGG + Intergenic
1089954981 11:122561941-122561963 CAGTGGAAACAGCCCAGGCAGGG - Intergenic
1090416782 11:126545865-126545887 CTGCAGAAGTACCTGAGGCAAGG + Intronic
1091672504 12:2462337-2462359 CTGTGCAGAGAGCTGAGCCAAGG - Intronic
1092210186 12:6640688-6640710 GTGAAGAAATAGCTGAGGCAAGG - Intronic
1093295968 12:17391942-17391964 CTAAGGAAATACCTGAGGCTGGG - Intergenic
1094355136 12:29569536-29569558 TTGTGGAAGTTGCTGAGACAGGG - Intronic
1094397729 12:30025831-30025853 ATGTAGAAATAGCTGAGACTAGG + Intergenic
1095276214 12:40285941-40285963 CTTTGGAAATTACTGAGACATGG + Intronic
1097755086 12:63399689-63399711 TTGGGGAAAGAGCTGAGGCAGGG - Intergenic
1097824136 12:64157221-64157243 CTGTAGGAAGAGCTGAAGCAGGG + Exonic
1098243009 12:68487629-68487651 CTGCGGAAAGTTCTGAGGCAAGG - Intergenic
1099389603 12:82063099-82063121 CTGGGGCAAGAGCTGAGACAGGG + Intergenic
1099864907 12:88267829-88267851 CTGTGAAATTATCTAAGGCATGG - Intergenic
1100458726 12:94777508-94777530 GTGTAGAAACAGCTAAGGCATGG - Intergenic
1104113373 12:125725176-125725198 TTGGGAAAAAAGCTGAGGCAGGG + Intergenic
1104688990 12:130810503-130810525 CTGGGGAAATGGCTGATGCCAGG + Intronic
1105755162 13:23457194-23457216 GTGTGGAGAAGGCTGAGGCAGGG - Intergenic
1105810802 13:23993598-23993620 CTGTGGGAAGGGCTGGGGCATGG - Intronic
1106099523 13:26682439-26682461 CTGTGAAAATAACTGACCCAAGG + Intronic
1108891159 13:55261549-55261571 CTGTGTAAATAAATGAAGCATGG + Intergenic
1112198513 13:97250993-97251015 CAGTGGAAATAGCAATGGCAAGG - Intronic
1112599333 13:100839913-100839935 CTGTGGAAATGGCTGCTGCCAGG - Intergenic
1112839046 13:103552933-103552955 CTGTGGATATAGGCCAGGCATGG + Intergenic
1114538297 14:23436731-23436753 CTCTGGATAAAGCTGAGGCTGGG - Intergenic
1114713785 14:24804174-24804196 CTGTGGAAACAGCAGAAGGAAGG - Intergenic
1114729794 14:24979969-24979991 CTTTGTCAATAGCTGAGGCATGG - Intronic
1115229167 14:31139602-31139624 CAGTGGAAAAAGCTGAGAAAAGG - Intronic
1115249332 14:31329608-31329630 CTGTGAAAGTAGGTGGGGCAGGG - Intronic
1116188123 14:41625496-41625518 ATGAAGAAATAGCTGAGGCTTGG - Intronic
1117300833 14:54425467-54425489 CTGTGGGTTCAGCTGAGGCATGG - Exonic
1117658666 14:57982405-57982427 CTGTGGACATAGCTGGTGCCTGG - Intergenic
1118921432 14:70153055-70153077 CTGTGGATATTGCTGAAGCTGGG + Intronic
1121227012 14:92328473-92328495 CTGGGGGACTAGATGAGGCAGGG + Intronic
1121590440 14:95102464-95102486 GTGTGGAAATACCTGAGAAAAGG - Intronic
1121718192 14:96091083-96091105 CTGTGGAGAAAACTGAGGCCAGG + Exonic
1122744848 14:103891550-103891572 CTGTGGCAGGAGCTGAGGCTGGG - Intergenic
1123796543 15:23777586-23777608 CTTTTGACATAGCTGAGGAAAGG - Intergenic
1124019009 15:25903024-25903046 CTGTGACCATTGCTGAGGCATGG + Intergenic
1125322478 15:38502899-38502921 CTGTGCTAATTGCTGAGGAAGGG - Intronic
1125795634 15:42402257-42402279 CAGTGGAAATAACACAGGCAAGG - Intronic
1126196922 15:45942078-45942100 ATTTGGAAAATGCTGAGGCAGGG + Intergenic
1126690492 15:51285505-51285527 TTGGGAAAAAAGCTGAGGCAGGG + Intronic
1128564550 15:68692008-68692030 CTGTGGAAGCAGATGATGCAGGG + Intronic
1129832452 15:78679612-78679634 CTATGGAAACAGGTGTGGCAGGG + Intronic
1131582241 15:93655687-93655709 CTGTGGAAATAATTTAGTCAAGG - Intergenic
1132400657 15:101502970-101502992 CAGTGGAGAAAGGTGAGGCATGG + Intronic
1133288345 16:4701786-4701808 CTATGGAAACAGCTGCTGCACGG + Intronic
1133704425 16:8339945-8339967 CTGTGGCAATAGCAAAGACATGG - Intergenic
1134882491 16:17757916-17757938 CTCAGGAAAGTGCTGAGGCATGG + Intergenic
1136073379 16:27802362-27802384 CTGTGGTCAGAGCTGAGGGAGGG - Intronic
1136104911 16:28023468-28023490 CAGTTGAAATTGCTGGGGCAAGG + Intronic
1136506057 16:30704102-30704124 CTGGGGAACTGGATGAGGCAGGG - Exonic
1137284874 16:47007184-47007206 ATGAGGAAACAGGTGAGGCATGG + Intergenic
1138096876 16:54218789-54218811 CTGGGGAAATAGCAGGGGCCAGG + Intergenic
1138461078 16:57148128-57148150 CTGAGGAAGGAGCTGACGCAGGG - Exonic
1139554056 16:67695102-67695124 CTGAGGTAGTAGCTGAGGCAAGG - Intronic
1140014777 16:71171213-71171235 CCGTGCAAATATCTGAGGGAAGG - Intronic
1140094626 16:71864292-71864314 CTGTTTAAAAAGCTGGGGCAGGG - Intronic
1140796711 16:78445227-78445249 TTGTGGAAATAGATGGGGTATGG - Intronic
1142118664 16:88375031-88375053 CTGTGCACACAGCTGGGGCAGGG + Intergenic
1143474615 17:7195600-7195622 CTCTGGAAATAGGTCAGCCAGGG + Intronic
1144440228 17:15274599-15274621 CTGTAGAAAGAGCTGAGGAGGGG + Intergenic
1146275213 17:31512055-31512077 CTGAGGAATTACCTGAGGCCAGG - Intronic
1146290045 17:31600307-31600329 CTGTGGAAATAGCCGAAGGGTGG + Intergenic
1146444844 17:32925492-32925514 CTGTAAAAATAGCTGAGTCTTGG + Intergenic
1148222226 17:45871117-45871139 CTTTGAAAATAGCTGATGAATGG - Intergenic
1148236338 17:45971729-45971751 CTGTGGAAACAGCTGGAACACGG - Intronic
1150650740 17:67008464-67008486 CTGGGCAAAGAGCTGAGGCATGG + Intronic
1150979250 17:70123091-70123113 CTGTTGAAATATCTGAACCAAGG - Intronic
1151279881 17:73065502-73065524 CTGTGGAATTGGAAGAGGCAGGG - Intronic
1151420567 17:73994368-73994390 CTCTGGCAATAGAGGAGGCATGG - Intergenic
1152015724 17:77749224-77749246 TTCTGGAGCTAGCTGAGGCAGGG - Intergenic
1152785543 17:82246123-82246145 CTGTGGACCTGGTTGAGGCAAGG - Intronic
1152846809 17:82605675-82605697 CTGTGGACATAGCTCAGAAAGGG - Intronic
1153713015 18:7819197-7819219 CTGTGGACATAGGTGAGGACAGG + Intronic
1155067234 18:22278513-22278535 GTGTGAAAATAGCTGAGCCCAGG + Intergenic
1156676133 18:39529379-39529401 CTATGGACCTAGCTGAGGAAAGG + Intergenic
1157534573 18:48448883-48448905 CAGAGGAAATAGCTTTGGCAAGG + Intergenic
1157584063 18:48790259-48790281 CTGGGGAAATAGCTCATCCAGGG + Intronic
1158517726 18:58144804-58144826 CTGTGGACATAGCAGTAGCAAGG - Intronic
1159553264 18:69918805-69918827 CTGTGCAAATAGGGGAGTCATGG + Intronic
1160171261 18:76557370-76557392 AGGTGGAAACAGCTGAAGCATGG - Intergenic
1160257926 18:77263392-77263414 GTGTTTAAATAGATGAGGCATGG + Intronic
1162023314 19:7878869-7878891 TTGGGGAAACAGCTGAGGGAAGG + Intergenic
1164019959 19:21292328-21292350 CAGTGGAAATATCTAAGGTAGGG - Exonic
1164211160 19:23098499-23098521 CTGTGGACAGGGCTGAGGCAGGG - Intronic
1166261165 19:41642174-41642196 CTGGAGAAATAGCTGATCCAGGG + Intronic
1166275946 19:41754020-41754042 CTGGAGAAATAGCTGATCCAGGG - Intronic
1167509713 19:49889611-49889633 CTGGGGAAGTAACTGAGCCACGG + Intergenic
1167753832 19:51397926-51397948 GTGAGAAAAAAGCTGAGGCAGGG - Intergenic
1167754428 19:51402919-51402941 TTGGGAAAAAAGCTGAGGCAGGG - Intergenic
925237562 2:2292901-2292923 CTGTGGAAATCGGTGAGACGGGG + Intronic
925378675 2:3408051-3408073 ATGTGGAACTAGCAGAGCCAGGG - Intronic
925486408 2:4337269-4337291 CTTTGGCAATTGCTGAGGGAAGG - Intergenic
925904947 2:8534829-8534851 CTGTGGAAGGAGCTGAGTCAGGG + Intergenic
925959332 2:9001167-9001189 CTGTGGAACAGCCTGAGGCAGGG - Intronic
927496110 2:23553092-23553114 CTGGGGAAAGAGGGGAGGCAGGG - Intronic
927817441 2:26231674-26231696 CTGTGGAATTAGGCCAGGCATGG + Intronic
927962740 2:27250810-27250832 CTGTGTAAAGAGCTGGGGCTGGG + Intergenic
929545919 2:42855195-42855217 GTGGGGAAATGGCTGAGGCCTGG + Intergenic
930666553 2:54104938-54104960 CTGTGTTACAAGCTGAGGCATGG + Intronic
931770062 2:65489597-65489619 AACTGGAAATAGCAGAGGCAAGG + Intergenic
931957089 2:67439516-67439538 GTGTGGAAAAAGCAGAGTCATGG + Intergenic
933614631 2:84471132-84471154 TTGGGAAAAAAGCTGAGGCAGGG - Intergenic
933615303 2:84477387-84477409 TTGGGAAAAAAGCTGAGGCAGGG - Intergenic
933629160 2:84636537-84636559 GTGAGGCAATAGGTGAGGCATGG - Intronic
934055403 2:88247485-88247507 TTCTTTAAATAGCTGAGGCAGGG - Intergenic
934959654 2:98659570-98659592 CTGTGGAGATAACTGAATCATGG + Intronic
935062362 2:99619853-99619875 CTGTGGAACTGGCTTAGTCATGG - Intronic
935209961 2:100931057-100931079 CTGTGGTGCTGGCTGAGGCAAGG - Intronic
935747128 2:106198350-106198372 CTAAGGAAATAGCAAAGGCAAGG + Intergenic
935764474 2:106352084-106352106 CTGTGGAAATATTTGTGGAAGGG - Intergenic
936256058 2:110913636-110913658 CTGAAGAAATACCTGAGGCTGGG + Intronic
936829011 2:116618097-116618119 CTGTGGCAATAACTGGGGTATGG - Intergenic
937041523 2:118824374-118824396 CTGGGGGAAAACCTGAGGCACGG - Intergenic
939057969 2:137385470-137385492 CTGTGGAAAGAGTTTAGACAGGG - Intronic
939280780 2:140061979-140062001 CTGTGGATTTTGTTGAGGCATGG + Intergenic
940277639 2:151956079-151956101 ATATGGAAATAGCTGAGATATGG + Intronic
941435447 2:165465400-165465422 CTAAGGAAATAGATGAGGCTTGG - Intergenic
943968335 2:194367759-194367781 TTGGGAAAAAAGCTGAGGCAGGG - Intergenic
947214689 2:227739331-227739353 TTGGGGAAAAAACTGAGGCAGGG + Intergenic
949061237 2:241958908-241958930 CTGTGGAAGTTGCTGATGCCAGG + Intergenic
1169210780 20:3765246-3765268 CTGTGGACACAGCTGCAGCAGGG - Intronic
1169666449 20:8041876-8041898 CTGTGGAAACAGCAGGGACATGG - Intergenic
1173470521 20:43320136-43320158 CTTTTGACCTAGCTGAGGCAGGG - Intergenic
1173489705 20:43469866-43469888 CTGTGGCACTGACTGAGGCAGGG - Intergenic
1174129174 20:48329658-48329680 ATGTGAAAATAACTGAGACAGGG + Intergenic
1174289562 20:49498244-49498266 CTGTGGAAATAGCAGGAGCAAGG - Intergenic
1175087766 20:56474516-56474538 CTCTGGAAATAGTTGAAACAGGG + Intronic
1175192901 20:57223496-57223518 CTATGGGAATCACTGAGGCACGG + Intronic
1179488230 21:41724441-41724463 CTGTGGAAAAGACTGAGGCTGGG + Intergenic
1180596913 22:16982768-16982790 TTGGGAAAAAAGCTGAGGCAGGG + Intronic
1181584698 22:23846714-23846736 GCTTGAAAATAGCTGAGGCAGGG - Intergenic
1181774157 22:25147701-25147723 CTGTGGAGAAAAATGAGGCAGGG - Intronic
1183077752 22:35437460-35437482 CTGAGGAAACAGCTGAGAGATGG + Intergenic
1183869317 22:40729290-40729312 TTGGGAAAAAAGCTGAGGCAGGG - Intergenic
950284841 3:11736640-11736662 TTGTGGTAATTGCTGAAGCAGGG - Intergenic
950454874 3:13086699-13086721 CTGTGCAGAGAGCTGAGGGAGGG - Intergenic
952229652 3:31416582-31416604 CTGGGGTAAGAGGTGAGGCATGG + Intergenic
953290971 3:41662346-41662368 CTTTGGAAATGGATGAGGGAAGG + Intronic
954915173 3:54142737-54142759 CTGATGAAGAAGCTGAGGCATGG + Intronic
956164180 3:66384058-66384080 ATGTGAAAATAGATGACGCAGGG - Exonic
956890324 3:73607018-73607040 GTGTGGAAAGAGTTGAGGGATGG - Intronic
960994178 3:123330246-123330268 CTTTAGAAATAGCTTGGGCAGGG - Intronic
961058999 3:123812683-123812705 CTTTGGAAATCCCTGATGCAGGG + Intronic
961475889 3:127146066-127146088 CTGTGGAGAAAACTGAAGCAGGG - Intergenic
964477802 3:157112192-157112214 CTGTTGAAGGAGATGAGGCAGGG + Intergenic
964651990 3:159022129-159022151 TTGGGAAAAAAGCTGAGGCAGGG + Intronic
964993649 3:162846390-162846412 CTGTGGAAATAACAGAGGGATGG - Intergenic
968706376 4:2080299-2080321 CTGGGGGAATAACTGAGGCAGGG + Intronic
969710645 4:8841072-8841094 CTGGGGAAAGGGCAGAGGCAAGG + Intergenic
970044531 4:11836589-11836611 CTGTGGTAATAGGAAAGGCAGGG - Intergenic
970276411 4:14405750-14405772 CTGTGGAAAGAGCTGGCACATGG + Intergenic
970311149 4:14783844-14783866 CTGTGGAAAGAGCAGTGGTATGG - Intergenic
971963277 4:33517105-33517127 TTGGGAAAAAAGCTGAGGCAGGG - Intergenic
971974737 4:33669492-33669514 CTGCTGAAATAGCTGCGACATGG + Intergenic
974087005 4:57272480-57272502 CTGTGGAAAATGATGAGGAAAGG - Intergenic
974980120 4:68945408-68945430 CTGTGGGAAAAGCTGAGATATGG - Exonic
975169480 4:71216457-71216479 CTGGGCACATGGCTGAGGCATGG - Intronic
975737040 4:77391101-77391123 CTGTAGAAATAACTGATCCAAGG - Intronic
976333930 4:83863930-83863952 CTGTGTAAATTGCTGAAGAATGG + Intergenic
976647691 4:87402474-87402496 TTGGGAAAAAAGCTGAGGCAGGG - Intergenic
978771222 4:112458014-112458036 CAGTGGTAATAGCAGAGGAAAGG + Intergenic
980754147 4:137135773-137135795 CGGTGGAAATAACTGAATCATGG + Intergenic
981223257 4:142261622-142261644 GTGGGGAAATAGCTCAAGCAAGG - Intronic
981961458 4:150544599-150544621 CTGTAGAAATTGCTGTGGCAAGG - Intronic
984565435 4:181324481-181324503 CAGTGGAAATTGCAGGGGCAGGG - Intergenic
986762083 5:10889498-10889520 CTCTGGAAATAGCAGAGGTCGGG + Intergenic
989098420 5:37802378-37802400 CTGTGGAAGTAGAAAAGGCAAGG - Intergenic
989518890 5:42377629-42377651 CAGTGGAAATTGCTGAGCAAAGG + Intergenic
992546416 5:77818111-77818133 CTTTGAAAATAGCTGAGGCTGGG - Intronic
993133637 5:83929818-83929840 CAGTGAAAGTGGCTGAGGCAGGG + Intergenic
993607730 5:90014540-90014562 CTGGTGAAATAGCAGAGGCCTGG + Intergenic
993736119 5:91478287-91478309 CTGTGGACATAGCAGTTGCAAGG + Intergenic
994205486 5:97030852-97030874 CTGTGGGAAAAACTGAGGCAAGG - Exonic
995924343 5:117352523-117352545 CTGTGGAAAGAGCAGATGCTCGG + Intergenic
997210099 5:132072158-132072180 CCCTGGAAAGAGCTGAGCCAAGG + Intergenic
998191658 5:140030477-140030499 CTGTGGGCATAGGTGAAGCAGGG + Intronic
1000072811 5:157756689-157756711 GTGGGGAAAAAGCTGAGGCACGG - Exonic
1001200832 5:169714687-169714709 CTCTGGAAATAGATGAGCCTGGG + Intronic
1001551201 5:172603423-172603445 CGGGGGAAAGAGCTGAGGAAAGG - Intergenic
1002526987 5:179820542-179820564 CTGAGGATATTGCTGAGTCATGG + Intronic
1004067047 6:12257518-12257540 CTGTGGAAATATCTGTAGAATGG + Intergenic
1005699785 6:28388796-28388818 CTGTGGAGTTTGCTGTGGCAGGG + Intronic
1005714028 6:28529983-28530005 CTCAGGAAAAAGCAGAGGCAGGG - Intronic
1006327415 6:33364974-33364996 GTGGGGAAACAGCTGAGGGAAGG + Intergenic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1006463304 6:34176614-34176636 CTGTGACAAGAGCAGAGGCAGGG - Intergenic
1007016613 6:38474226-38474248 TTCTGGAAAGAGCTGAGGCTGGG + Intronic
1008040271 6:46790029-46790051 GTGTGGAAATAGCTGGGGGCGGG + Intergenic
1008285486 6:49644135-49644157 CTGTGGTAATAGCAAAGACATGG - Intergenic
1010391436 6:75342780-75342802 CTGTGGAAATAGCTGAGGCAGGG - Intronic
1011325478 6:86146726-86146748 TTGGGAAAAAAGCTGAGGCAGGG + Intergenic
1011805865 6:91071992-91072014 CTGTGAAAGTAGCTGGGGCAAGG + Intergenic
1012085391 6:94819235-94819257 CTCTGGAAATAGTTGAGGAAAGG - Intergenic
1012470902 6:99571309-99571331 CTGTGAAGAAAGCTGAGGCCAGG + Intergenic
1012996743 6:105982313-105982335 CTATGGAGAAAGCAGAGGCATGG + Intergenic
1013397941 6:109761803-109761825 CTTTGGAGAAAGCTCAGGCAGGG + Intronic
1013862477 6:114652379-114652401 CTGTGGTAATAACTGGGGTAGGG - Intergenic
1014684566 6:124479541-124479563 CTGTGACAATAATTGAGGCATGG + Intronic
1014834036 6:126138518-126138540 CTGTGGCTATACCTGAGGTAAGG + Intergenic
1016256242 6:142109113-142109135 CTATGAAAACAGCTGAAGCAGGG - Intergenic
1016727281 6:147387906-147387928 CTGGGGAGACAGCTGAGGAAAGG + Intergenic
1018903179 6:168061261-168061283 CTGTGGTAAACGCTGAGGCGAGG + Intronic
1019506514 7:1394092-1394114 CTGAGCACATAGCTGAGGCTTGG - Intergenic
1020334856 7:7055258-7055280 CTGGGAAGAGAGCTGAGGCAGGG - Intergenic
1021132491 7:16927994-16928016 CTGTGGAGATAGATTAAGCAGGG - Intergenic
1022466371 7:30655459-30655481 CTGTGGATGTAACTGAGCCATGG + Intronic
1022488159 7:30796048-30796070 ATGTGGACATAGTTGAGGGAGGG + Intronic
1022617418 7:31946217-31946239 TTGGGAAAAAAGCTGAGGCAGGG + Intronic
1024448388 7:49509441-49509463 CTATGGAAACAGCTGTTGCAGGG - Intergenic
1026500446 7:70939021-70939043 CTCAAGAAATAGCTGAGGCCAGG - Intergenic
1030463003 7:109864005-109864027 CCATGGAAATACCTTAGGCAAGG + Intergenic
1032525213 7:132574779-132574801 GTTTGGAAATAGCGGAGTCAGGG + Intronic
1032978635 7:137254875-137254897 CTGTGGATACTGCTGAAGCAGGG - Exonic
1035170829 7:157016706-157016728 CTGTGAGAAGAGCTTAGGCAGGG - Intergenic
1036573865 8:10006475-10006497 CTATGGAGAAAACTGAGGCAAGG + Intergenic
1037471710 8:19216866-19216888 CTGTGGAAATGGGCAAGGCAGGG - Intergenic
1041718872 8:60958007-60958029 CTATGGAAAGATCTGAGGCAGGG + Intergenic
1043271489 8:78339578-78339600 CCCTTGCAATAGCTGAGGCATGG + Intergenic
1045508221 8:102793756-102793778 CTGTGGAAAGAGATGGGTCAGGG - Intergenic
1045612119 8:103857096-103857118 GTGTGGTAATAGCTGAGATACGG + Intronic
1046346547 8:112936114-112936136 ATGTGGAAATAGCAGAAGCGAGG - Intronic
1048748171 8:137639144-137639166 CTGGGGAAAGAAATGAGGCAGGG - Intergenic
1049576872 8:143393640-143393662 CAGTGGACAGAGCTGAGGCCTGG - Intergenic
1051409885 9:16778679-16778701 CAGTGGAAAGAGCTCAGGCTTGG - Intronic
1051587783 9:18745509-18745531 CTGTAGAAATAGCTGACGTCTGG - Intronic
1051681998 9:19616940-19616962 CTATGGAAAAACCTGGGGCAGGG + Intronic
1051812612 9:21067375-21067397 GTGAGTAAATAGCAGAGGCAAGG - Intergenic
1052628303 9:31004900-31004922 CCCTGGAAATAGCTGAGGCCAGG + Intergenic
1053095482 9:35323812-35323834 CTGTAGAAACAGGTTAGGCAAGG - Intronic
1053567845 9:39271605-39271627 CTGTGGGAACAGATGAGGCCTGG + Intronic
1053833852 9:42112552-42112574 CTGTGGGAACAGATGAGGCTTGG + Intronic
1054129298 9:61347394-61347416 CTGTGGGAACAGATGAGGCCTGG - Intergenic
1054596700 9:67074858-67074880 CTGTGGGAACAGATGAGGCTTGG - Intergenic
1055841186 9:80506010-80506032 TTGTGTAATTAGCTGAGGCTAGG - Intergenic
1056762189 9:89423765-89423787 CTGAGGGAGTAGCTGAGGGAGGG - Intronic
1056762206 9:89423823-89423845 CTGAGGGAGTAGCTGAGGGAGGG - Intronic
1056762218 9:89423869-89423891 CTGAGGGAATAGCTGAGGGAGGG - Intronic
1056762233 9:89423927-89423949 CTGAGGGAGTAGCTGAGGGAAGG - Intronic
1057919526 9:99085522-99085544 ATGTGGAACTGTCTGAGGCAAGG - Intergenic
1059434521 9:114267979-114268001 CCGTGGACATTGTTGAGGCAGGG + Intronic
1060110989 9:120906050-120906072 CTGGGGAAACAGGTGGGGCAGGG - Intronic
1060645658 9:125277343-125277365 ATGAGGAAATATCTGAGTCAAGG + Intronic
1060770415 9:126327629-126327651 CTGGGACAAGAGCTGAGGCATGG + Intronic
1061618463 9:131795206-131795228 CTGAGGAAATAGCAGGTGCAAGG - Intergenic
1062094941 9:134698275-134698297 CTGTGGGAACAGCTGAGTCATGG + Intronic
1186246439 X:7621092-7621114 CTGAGAAAATAGCAGAAGCAAGG - Intergenic
1186417234 X:9394314-9394336 CTGAGGAAATAGCTGTGGGTCGG + Intergenic
1188734044 X:33690367-33690389 CTGTGGAAACTGTTGAAGCATGG - Intergenic
1189259314 X:39666883-39666905 ATATGGAAATAGCTGTGCCATGG + Intergenic
1189667735 X:43375486-43375508 CTGTGGAAAGTGCTAAAGCAAGG - Intergenic
1189670632 X:43404680-43404702 CTGTGCAAAGGGCTGAGGAAGGG + Intergenic
1190320124 X:49175156-49175178 GAGTGGAAACAGCTGGGGCAAGG + Exonic
1190441372 X:50478088-50478110 CTGTGAAAATATCTGGGGAAAGG + Intergenic
1191693479 X:63964428-63964450 CTGTGTAAATAGCTGAAGGAAGG - Intergenic
1191971084 X:66817029-66817051 CTGTGAAAATATCTGGGGAAAGG + Intergenic
1192216253 X:69161383-69161405 TTGTGGAAATAGTGGTGGCACGG + Exonic
1194423163 X:93702245-93702267 CTGTAGAAATAGCTGATTCTAGG + Intronic
1194764153 X:97829668-97829690 ATTTGGAAATAGCTGGGGCGTGG - Intergenic
1196303423 X:114072240-114072262 CTGTAGCAATAGCTGAGTCTTGG - Intergenic
1199947806 X:152681844-152681866 CTGCGGAAACAGCAGGGGCAAGG - Intergenic
1199954984 X:152735325-152735347 CTGAGGGAATAGCAGGGGCAGGG - Intronic
1199961873 X:152786610-152786632 CTGCGGAAACAGCAGGGGCAAGG + Intergenic